1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
10

1. . Wht are receptors? Name the receptors in (a) nose (b) taste buds.

Biology
1 answer:
hoa [83]3 years ago
6 0

Receptors in the nose are olfactory receptors and they are the things that basically give you the ability to smell different smells.

Receptors kind of allow you to feel or smell or hear etc.

Receptors in the taste buds are simply taste receptors, they help you taste different foods and such.

You might be interested in
What are the characteristic of a quib?
Zolol [24]

Answer:

D. It has a strong influence on the ecosystem.A keystone species is a non-abundant species in an ecosystem. This species is important for the survival of the ...

Explanation:

7 0
3 years ago
Read 2 more answers
What are some covalent compound that we use in everyday life?
ICE Princess25 [194]
Carbon dioxide and hydrogen monoxide
7 0
3 years ago
The two cerebral hemispheres are separated by the
MAXImum [283]

Answer:

The correct answer is A. The two cerebral hemispheres are separated by the longitudinal fissure.

Explanation:

The longitudinal or intercerebral fissure is a deep cleft that divides the brain longitudinally into two hemispheres (the right and the left) joined together by the corpus callosum. Other fissures, such as the central sulcus, the lateral sulcus and the internal perpendicular fissure, divide each hemisphere into large cerebral lobes, which in turn have cerebral convolutions.

6 0
3 years ago
Which of the following requires eIFs for initiation? Which of the following requires eIFs for initiation? eukaryotic translation
andre [41]

Answer:

Eukaryotic translation.

Explanation:

Translation is the process of the formation of the proteins from the RNA molecules with the help of different enzymes and proteins. Translation is quite different in case of prokaryotes and eukaryotes.

The initiation in case of eukaryotes requires different enzymes and translation factors. eIFs are the initiation factors that contains proteins and required for the initiation of eukaryotes translation. eIF1 and eIF1A are the proteins binds with the 40'S ribosome subunit of eukaryotes.

Thus, the correct answer is option (1).

4 0
3 years ago
Which description of Alexander Hamilton is correct? A. a former British captain who turned a disorderly group of American recrui
FinnZ [79.3K]
B it could be D but you pick what you feel is right Good luck Luv!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Decribe how an ionic bond is formed?
    8·1 answer
  • Science<br>What does equilibrium mean?
    14·2 answers
  • how do roller coaster engineers and park safety manager address the excessive G- forces exerted by roller coaster on its riders?
    11·1 answer
  • Use this new information to determine the parents' genotypes (indicated by red arrows). then calculate the probabilities that th
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which substance from the light- dependent reactions of a source of energy
    13·1 answer
  • Draw a chart mapping out all aquatic ecosystems and how they interact amongst one another
    12·1 answer
  • Explain the conversation of mass during cellular respiration
    12·1 answer
  • what change in a population would you expect to see if a selection pressure was against the traits of the dominant allele?
    8·1 answer
  • What animals in the phylogenetic tree has a body cavity?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!