1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
4 years ago
6

A person with type AB blood has __________ RBC antigen(s).

Biology
1 answer:
artcher [175]4 years ago
5 0

Answer:

it is B

Explanation:

it is Anti-A Individuals with type AB blood have both A and B antigens,

You might be interested in
PLEASE HURRY!!!<br> ILL GIVE 15 POINTS AND BRAINLY FOR THE RIGHT ANSWER<br> SCREENSHOT ATTACHED
ICE Princess25 [194]

Answer:

1.prokaryote-The type of cell that contains only two basic parts: the cell membrane and cytoplasm. (It does not have a nucleus. Bacteria are an example of this cell.)

2.Cell wall- foruth part of a cell(only found in plants)

3.Eukaryote-Contains 3 parts the cell membrane, the cytoplasm, and the nucleus

4.Nucleus-command center

5.Cell-Basic unit of life

6.cytoplasm-fluid material

Hope This helps

5 0
3 years ago
Read 2 more answers
Why is blood type AB+ considered the universal receiver?
denis-greek [22]
Because the can receive blood from any person with blood type of O,A.B and AB.
6 0
3 years ago
The process by which plants convert sunlight into chemical energy is cellular respiration diffusion mitosis photosynthesis
Alexxandr [17]
Photosynthesis is the answer
4 0
3 years ago
Read 2 more answers
The proteolytic enzyme trypsin is produced in the pancreas as the zymogen trypsinogen. Trypsinogen is cleaved to yield the activ
Nesterboy [21]

Enteropeptidase (enterokinase) and trypsin are directly activated by trypsinogen.

<h3>What is Trypsin?</h3>
  • By slicing these lengthy chains of amino acids into smaller pieces, the enzyme trypsin in the first part of the small intestine initiates the breakdown of protein molecules. It is a serine protease from the PA clan superfamily that hydrolyzes proteins in the digestive tracts of numerous animals.
  • When the pancreatic enzyme trypsinogen, in the proenzyme form, is activated, trypsin is generated in the small intestine. The carboxyl side of the amino acids lysine or arginine is where trypsin primarily breaks peptide chains.
  • It is employed in a variety of biotechnological procedures. Trypsin proteolysis or trypsinization is the term used to describe the process, and trypsinized proteins are those that have undergone trypsin digestion or treatment.

To know more about trypsin with the given link brainly.com/question/14301571

#SPJ4

3 0
2 years ago
The branch of biology dealing with interactions among organisms and between organisms and their environment is called
barxatty [35]

The answer is Ecology.

3 0
4 years ago
Read 2 more answers
Other questions:
  • What country did hurricane harvey occur?
    6·1 answer
  • What are the general features of the prymnesiophyceae
    9·1 answer
  • What does scientific mean?
    10·1 answer
  • True or false meiosis I is sexual reprodiction in eukartotes
    7·2 answers
  • Radiation is produced by....?
    9·1 answer
  • Three-month-old brianna would be expected to have the lowest skin temperature when she's
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • In dry environments, farmers often dig wells to provide irrigation for their crops. Which of the following is an environmental r
    9·2 answers
  • Please helpp<br> I don't understand this at all
    6·1 answer
  • Which of the following is the best explanation for why carbon easily forms
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!