1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
6

Which of these is a characteristic of science?

Chemistry
2 answers:
jenyasd209 [6]3 years ago
5 0

The correct answer is D. It gives the same result when experiments are repeated.

Explanation:

Science refers to a system or discipline that aims at understanding phenomena that is testable mainly through multiple observations, hypotheses, and testing. Because of this, characteristics of science include that it is based on facts or ideas that have been proved, it is useful for answering testable questions and also the findings are replicable which means if tested multiple times same results would be obtained which proves phenomenons and events are facts and do not depend on opinions or personal views. Considering this, the one that is a characteristic of science is that "It gives the same result when experiments are repeated".

Ivahew [28]3 years ago
3 0

D. It gives the same results when experiments are repeated

You might be interested in
The respiratory system is what brings in food and breaks it down True or false
Gala2k [10]

Answer:

false

Explanation:

the respiratory system includes the lungs and heart

not food

5 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
a compound has 15.39 g of gold for every 2.77 g of chlorine. simplified there is _____ g of gold for every 1 g of chlorine
iren [92.7K]

Answer:

There is 5.56 g of gold for every 1 g of chlorine

Explanation:

The ratio is the relationship between two numbers, defined as the ratio of one number to the other. So, the ratio between two numbers a and b is the fraction \frac{a}{b}

You know that a compound has 15.39 g of gold for every 2.77 g of chlorine. This can be expressed by the ratio:

\frac{15.39 g  of gold}{2.77 g of chlorine}

The proportion is the equal relationship that exists between two reasons and is represented by:    \frac{a}{b}=\frac{c}{d}

This reads a is a b as c is a d.

To calculate the amount of gold per 1 g of chlorine, the following proportion is expressed:

\frac{15.39 g  of gold}{2.77 g of chlorine}=\frac{mass of gold}{1 g of chlorine}

Solving for the mass of gold gives:

mass of gold=1 g of chlorine*\frac{15.39 g  of gold}{2.77 g of chlorine}

mass of gold= 5.56 grams

So, <u><em>there is 5.56 g of gold for every 1 g of chlorine</em></u>

5 0
3 years ago
How much energy must a 10 gram block of ice gain in order to melt ?
Minchanka [31]

Answer:

the answer is 10 times

Explanation:

because it takes 10 times as much energy -3330 j - to melt 10.0 grams of ice.

8 0
1 year ago
Jai besoi daide
JulijaS [17]

Answer:

i dont know what you are saying

Explanation:

????????????

4 0
2 years ago
Other questions:
  • When is a roman numeral most likely needed in the name of an ionic compound?
    9·2 answers
  • Sulfur molecules exist under various conditions as s2. True or Fasle
    11·1 answer
  • An element has atomic number 10 and an atomic mass of 20. How many neutrons are in the atom of this element?
    14·1 answer
  • Which of the following is NOT a strong acid or strong base?
    13·1 answer
  • A sample of carbon dioxide gas (CO2) contains 6 x 1022 molecules. How many moles of carbon dioxide does this represent?
    15·1 answer
  • What type of organic compounds are sugars and starches?
    7·2 answers
  • 20 mL of 80°C water is mixed with 20 mL of 0°C water in a perfect calorimeter. What is the final temperature?
    7·1 answer
  • Which statement about the half-life of a radioactive sample is true?
    11·2 answers
  • Construct the inequality for the following cases.
    7·1 answer
  • Someone pls help me I will mark you as brain
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!