1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
4 years ago
10

Which of the following statements would explain a testcross involving F1 dihybrid flies in which more parental-type offspring th

an recombinant-type offspring are produced? a. Recombination did not occur in the cell during meiosis. b. Both of the characters are controlled by more than one gene. c. The two genes are linked but on different chromosomes. d. The two genes are closely linked on the same chromosome.
Biology
1 answer:
pickupchik [31]4 years ago
8 0

Answer:

d. The two genes are closely linked on the same chromosome.

Explanation:

In a testcross involving F1 dihybrid, parent with both the recessive traits is crossed with the F1 dihybrid. Offspring is expected in 1:1:1:1 ratio because formation of gametes is a random process and parental type and recombinant type gametes are expected to be produced in same numbers.

If the two genes are present near to each other on same chromosome they can exhibit linkage. They show tendency to get inherited together. Hence new recombinants are produced in lesser number than the parental type offspring.

You might be interested in
List the major subdivisions or components for each of the four types of compounds—carbohydrates, lipids, proteins, and nucleic a
kobusy [5.1K]
Carbohydrates - Sugars 
Lipids - Fats
Proteins - Enzymes, Amino Acids
Nucleic Acid - DNA and RNA
3 0
4 years ago
How can DNA be useful in phylogeny?
mash [69]

Answer:

Option A is correct

......

7 0
4 years ago
Read 2 more answers
How are alligators and duck ALIKE and DIFFERENT?
Slav-nsk [51]

Well... to start off with,

DIFFERENCE: Ducks are fluffy and soft, alligators are not.

ALIKE: ducks bite and alligators bite.... Alligators swim and ducks swim as well.

Hope this helps! (:

-Autumn Leaves

4 0
3 years ago
Which phase of cell division results in the formation of four new haploid cells?
AlekseyPX
The answer is...
A.Telophase II
8 0
3 years ago
Read 2 more answers
A dense group of bacteria that are difficult to treat with antibiotics is called A. a biofilm. B. parasitic. C. a plasmid conjug
Ede4ka [16]

Answer:

A. A biofilm

Explanation:

Biofilms have high bacterial density near to 10000000 CFU/ml bacteria. Due to such high densities, these biofilms becomes resistant to the antibiotics. These biofilms are basically community of microorganisms which stick itself to some kind of surface be it living or non-living. The bacteria’s which get attached to these biofilm and grow in an environment in which they possess both tolerance and resistance towards any bactericidal agent. Due to this functional mechanism of bacterias with in the biofilm, they become resistant to antibiotics.

4 0
3 years ago
Other questions:
  • If changes in a genes' DNA sequence can change proteins, which of the following statements is false?
    14·1 answer
  • Both aerobic and anaerobic respiration yield a net gain of ATP molecules to be used as energy for living things. The processes o
    5·2 answers
  • The protective ring of lymphoid tissue around the back of the nose and upper throat is formed by the __________.
    12·1 answer
  • The trees in a forest all have closed stomata. what is the cause?
    14·1 answer
  • Place the following words into the illustration below: gametes, sporophyte, gametophyte, and zygote. Explain how the terms are r
    14·1 answer
  • The embryo of an animal forms a blastopore that deepens to form the digestive tract. This blastopore then develops into a mouth.
    5·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Biology chapter 33 assessment 972
    5·1 answer
  • What is the porosity of the sand sample?<br> A)<br> 99%<br> B)<br> 72%<br> C)<br> 34%<br> D)<br> 16%
    9·2 answers
  • All matter has:<br><br> cells<br> properties<br> seeds
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!