1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
3 years ago
11

Protists are very diverse, and many different classification schemes have been used to define relationships between the protists

. Traditionally, protists have been classified by their source of energy and nutrients, while newer classification schemes use mode of locomotion. How are amoeboids classified using both of these schemes?
A. photosynthetic, cilia
B. heterotrophic by absorption, nonmotile
C. heterotrophic by ingestion, nonmotile
D. heterotrophic by ingestion, pseudopods
Biology
1 answer:
andrey2020 [161]3 years ago
4 0

Answer:

D. heterotrophic by ingestion, pseudopods

Explanation:

Protists are generally classified  as all eukaryotic organisms that are not plants, animals or fungi. Example is amoeba, paramecium etc.They may be unicellular or multi cellular in nature.Most exist in colonies.

Their mode of nutrition can be photosynthetic or hetrotrophic. Hetrotrophic  protists   can be divided into  phagotrophs and osmotrops/saprotrophs. The phagotrophs  makes use of the cell body to engulf the food materials as  in amoeba ,carry out extracellular digestion before swallowing it.

Osmotrops absorbed dissolved food from surrounding liquid environments directly. (Some photosynthetic protists can also be heterotrophic.

Amoeboid movement is the mode of locomotion of protists and some  other eukaryotes. It involved the protrusion of cytoplasm, which exert pressure on the cell membrane to form pseudopodia and  the posterioly  evolved  <u>Uropods. </u>

<u />

<u>  </u>

<u>Sol-gel theory has been proposed to expalin this movements, The ectopalsm of amoeba is gelly-like , while the endiplams is less viscpus   and said to be sol. The interchange of the cytoplasmic fluis between the endo-and ecto plasm gives the SOL-GEL propulsion of the protopalms for the amoebic moveemnts .</u>

<u />

<u>The false feet(psuedopodium) drags the amoeba  along in the direction of the flow of the cytoplasm.</u>

Therefore option D is  the right option

You might be interested in
Sentence with electron transport chain?
sukhopar [10]
The electron transport chain is the final stage of aerobic respiration leading to the forming of ATP in the inner membrane of the mitochondrion<span>. 

</span>Mitochondrion<span>, is a membrane-bound organelle found in the cytoplasm of almost all eukaryotic cells. 
</span>
<span>An eukaryote is any organism whose cells contain a nucleus and any other organelles within the membranes.</span>
6 0
2 years ago
Water sticking to a blade of grass in the morning would be an example of which of the following?
77julia77 [94]
Answer is adhesion
just had this for my test
5 0
3 years ago
Read 2 more answers
What is an individual in an ecosystems?<br> {Give some examples}
Nikolay [14]
Try a bat for a ecosystems
4 0
3 years ago
Why would a grassland ecosystem have more primary consumers than a forest ecosystem
Lorico [155]

Answer:

Grass is easier for herbivores to digest.

The energy in trees is less available to herbivores

Explanation:

7 0
3 years ago
Read 2 more answers
What state of matter is the air inside hot air balloon.
Vlada [557]
Gas WHY TF DO I HAVE TO PUT 20 CHARACTERS
5 0
3 years ago
Read 2 more answers
Other questions:
  • I need help with this
    10·1 answer
  • The fact that the type IIR and IIS strains of Streptococcus pneumoniae that Griffith worked with possessed small differences in
    7·2 answers
  • Meiosis vs. mitosis
    8·1 answer
  • Identify the products of photosynthesis. carbon dioxide and glucose glucose and oxygen carbon dioxide and water light energy and
    11·1 answer
  • Why are your chromosomes arranged in pairs
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • According to the RNA Hypothesis it is believed that all living things came from a common ancestor. What evidence supports this t
    5·1 answer
  • One difference between mitochondria and chloroplasts is
    11·1 answer
  • In cellular respiration, glucose __________ electrons, whereas __________ electrons.
    7·1 answer
  • What is the rate of temperature change as the air warms up from 52C at 6:00am to 68C at 10:00an?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!