1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
2 years ago
5

What does a plant cell have that an animal cell doesn't have?

Biology
2 answers:
SIZIF [17.4K]2 years ago
6 0
Chloroplasts. As an animal doesn't
azamat2 years ago
4 0
A plant cell has chloroplasts.
 An animal cells doesn't.
You might be interested in
What is it important to creat new cells? list 3 reasons why mitosis is important.​
ivanzaharov [21]
You are amazing smile today! make sure you drink water and eat!!
8 0
3 years ago
Your heart functions in your body as a(n)
Bess [88]
The most appropriate answer is D !!
8 0
2 years ago
14. Scientist wanted to know if temperature effected the movement of
Advocard [28]

Answer:

movement

Explanation:

the movement depends on the temp.

7 0
2 years ago
Read 2 more answers
A group of nursing students is reviewing the similarities and differences between bulimia nervosa and binge eating disorder (bed
rewona [7]

I'm not sure of the options listed but: clients typically are obese and clients refrain from purging behaviors.

6 0
3 years ago
Which kind of carbon dating can be used to determine the exact age of the rock and which kind of carbon dating is used to compar
KATRIN_1 [288]

They use absolute dating methods, sometimes called numerical dating, to give rocks an actual date, or date range, ... However, there are radiometric dating methods that can be used on sedimentary rock, including luminescence dating

i hope this help

sorry if it wrong

7 0
3 years ago
Other questions:
  • The capillaries are the smallest and most ________ of the blood vessels
    5·2 answers
  • Who was george mendel and what was his greatest contribution to genetics?
    9·1 answer
  • 2. what ethical considerations will arise if this research is pursued?
    11·1 answer
  • Can someone please help me?
    15·1 answer
  • Social networks and the reciprocal norms associated with these networks that encourage people to do things for each other are kn
    5·2 answers
  • The biological 'job' of shrimp in the ocean is to feed on organic matter such as dead sea grass, bacteria, and dead fish. On lan
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • PLSSS HELP ASAP IF YOU TURLY KNOW THIS:)
    5·2 answers
  • sumone help me with these type of punnett squares and if i can text sumone so they can help me with other punnett squares that i
    5·1 answer
  • The DNA determines the RNA, and the RNA determines the protein, and the protein<br> determines the ?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!