1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergeinik [125]
3 years ago
12

Consider the formation of nitrogen dioxide from nitric

Chemistry
1 answer:
Temka [501]3 years ago
6 0

Answer:

9 L

Explanation:

According to the question , the given reaction is -

2NO(g) + O₂(g)------->2NO₂(g)

Since ,

At STP ,

One mole of a gas occupies the volume of 22.4 L.

Hence , as given in the question -

9 L of NO , i.e .

22.4 L = 1 mol

1 L = 1 / 22.4 mol

9 L = 1 / 22.4  * 9 L = 0.40 mol

From the chemical reaction ,

The Oxygen is in excess , hence NO becomes the limiting reagent , and will determine the moles of product .

Hence ,  

2 moles of NO will produce 2 moles of NO₂.

Therefore ,

0.40 mol of NO will produce 0.40 mol of NO₂.

Hence , the volume of NO₂ can be calculated as -

1 mol = 22.4 L

0.40 mol = 0.40 * 22.4 L = 9 L

You might be interested in
Isra is analyzing the properties of several samples of elements to find out which sample is a metalloid. Which set of properties
Tatiana [17]

Answer:

Low luster, can conduct electricity

4 0
3 years ago
Read 2 more answers
Many popular beverages are sold in two-kilo bottles. true or false
Molodets [167]
False. The answer is liter. kilo is the base (liter) times 1000. it would make no sense.
5 0
3 years ago
In the reaction H2SO4 + 2 NaOH -> Na2SO4 + 2H2O, an equivalence point occurs when 29.43 mL of 0.1973 M NaOH is added to a 32.
Tamiku [17]
            moles NaOH = c · V = 0.1973 mmol/mL · 29.43 mL = 5.806539 mmol
            moles H2SO4 = 5.806539 mmol NaOH · 1 mmol H2SO4 / 2 mmol NaOH = 2.9032695 mmol
Hence
            [H2SO4]= n/V = 2.9032695 mmol / 32.42 mL = 0.08955 M
The answer to this question is  [H2SO4] = 0.08955 M

6 0
3 years ago
How many liters of o2 do you have if you have 5.8 moles of o2
polet [3.4K]

Answer:

130 Liters

Explanation:

if 1 mol is 22.4 L, then 5.8 mol is 130 L (129.92 but use sig figs)

3 0
3 years ago
Which expression is equal to the number of grams (g) in 2.43 kilograms (kg)?
Gre4nikov [31]
2.43 kilograms is equal to 2430 grams because 1 kilogram is equal to 1000 grams.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Give three examples of elements that are gases at room temperature
    10·1 answer
  • A cubic centimeter is equal in volume to a _____.
    7·2 answers
  • Which type of investigation is based on observation?
    13·1 answer
  • Which statement correctly describes the relationship between reactant and yield? The actual yield is calculated from the amount
    14·2 answers
  • How many moles of glucose (C6H12O6) are in 6.0 liters of a 3.5 M C6H12O6 solution?
    11·2 answers
  • if a mixture of 90 g of hydrogen sulfide and 70.5 g of chromium oxide are allowed to raeact what mass of water can be formed
    11·1 answer
  • Which set of these comparisons is INCORRECT? (More stable means it has a more negative energy.) a) The 1s orbital in H is more s
    11·1 answer
  • What is the total number of distinct 13C NMR signals that may be observed for the product, methyl-3-nitrobenzoate, and for the r
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Helpppppppppppp me pleaseeeeeee<br><br>​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!