1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
4 years ago
14

What is megnet!?!?!?!?!?!!?!??!?!?!?!?!?!?!?!?!?!?!?!?!?

Biology
2 answers:
sleet_krkn [62]4 years ago
5 0
<span> object or a device that gives off an external </span>magnetic<span> field</span>
Sloan [31]4 years ago
3 0
A magnet is a field or object that produces an magnetic field.

Your answer is: Produces magnetic field 

Have an amazing day!
You might be interested in
Local topography and sea surface temperature contribute to differences in climate between various localities.
slava [35]
The correct answer for the given statement above would be true. Yes, it is true that local topography and sea surface temperature contribute to differences in climate between various localities. In fact, these factors contribute largely towards variations in the climate of places. Hope this answers the question.
3 0
3 years ago
what were the historical reasons for the resistance to recognizing airborne transmission during the covid-19 pandemic?
ExtremeBDS [4]

Up until a 1962 demonstration of tuberculosis airborne transmission, airborne transmission of all major respiratory diseases was assumed to be of insignificant or moderate consequence over the following fifty years.

Before COVID-19, only a small number of diseases—those that were blatantly spread to people not in the same room—were generally acknowledged as airborne. This is because the contact/droplet paradigm remained popular.

<h3>What does the term "airborne transmission" mean?</h3>
  • The term "airborne transmission" refers to the propagation of droplet nuclei (aerosols) that retain their infectious properties after being suspended in air for a lengthy period of time and over great distances.
  • Bacteria or viruses that cause airborne infections are most frequently spread by tiny respiratory droplets. When a person with the airborne sickness sneezes, coughs, laughs, or exhales in any other way, these droplets are released.

learn more about airborne transmission here

brainly.com/question/27807193

#SPJ4

6 0
1 year ago
Explain why the cane toad was a failure as a biological control method in Australia.
kakasveta [241]
The cane toad was a failure as a biological control method in Australia because:
-The greyback beetle it was supposed to be eating fed at the top of the sugarcane stalks (which were 6-8 meters in height). Cane toads cannot fly or climb and therefore couldnt feed on the beetles.
-The beetles were out during the daytime, and cane toads feed at night.
-The two species are not seasonally compatible (aren't in the same place at the same time of year).
-The toads needed moist conditions to survive, and so moved away from where they were supposed to be.
-The cane toad eats many native species and often out-competes native species for food and breeding sites, leading to the decline of natives.
-Breeding habits made the cane toads a very invasive species.
7 0
3 years ago
Which compound is a metabolic intermediate of the light-independent reactions in photosynthesis?
Evgesh-ka [11]
Carbon dioxide is the compound in photosynthesis, I'm pretty sure
7 0
3 years ago
Read 2 more answers
What two things must come together to form a seed?
Dmitry [639]

Answer:

Double fertilization involves two sperm cells; one fertilizes the egg cell to form the zygote, while the other fuses with the two polar nuclei that form the endosperm. After fertilization, the fertilized ovule forms the seed while the tissues of the ovary become the fruit.

7 0
3 years ago
Other questions:
  • Select all that apply.
    15·2 answers
  • What is true of all body cells except sex cells?
    7·2 answers
  • Which of the following is not an example of a plant defense against herbivory? A) nicotine B) cryptic coloration C) spines D) th
    7·1 answer
  • A scientist testing the effects of a chemical on apple yield sprays an orchard with the chemical. A second orchard does not rece
    11·1 answer
  • PLEASE HELP ASAP!!!!!!!
    13·1 answer
  • A prokaryote has a Gram-negative cell wall and a basic cell membrane, is spiral shaped, and has two polar flagellA. Referring to
    10·1 answer
  • Describe two examples of negative effects air pollutants have on the human respiratory<br> system
    5·2 answers
  • PLS HELP TIMES TEST I HAVE 49 MINUTES LEFT AND THERES 41 QUESTIONS IM ON 14
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The human brain communicates with the rest of the body through networks of what?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!