1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
6

The biggest increase in population is economically developing nations rather than economically developed nations why do you thin

k this is the case? Explain.
Biology
1 answer:
Lelu [443]3 years ago
6 0

The main reason for such trends are that the people from the developed nations tend to focus more on their careers and form families later in life, while in the developing countries it is the other way around.

Explanation:

In the developing countries, the population is increasing, while the developed countries it either stagnates or it is decreasing. There are many reasons that contribute to this, but the two main ones are the pursuing of career and forming a family later in life, or in the other case lacking options for career and forming family early in life.

In the developed countries, the people have much more options in life, so while they finish with the education they are already in their mid twenties, and while they progress on the labor market and reach a career goal they are usually in the mid to late thirties. This means that they often delay the formation of family and having children, so even if they want to they don't really have enough time to have lot of children, so usually have only one or two.

In the developing countries it is the opposite. The people are poor, usually have low education, no real prospects for career and instead work in agriculture. They tend to get married very young, even before their twenties, so they have much more children both because they have time on their side for it and because they need them as labor force and to contribute financially once they grow up a bit.

You might be interested in
Prevention measures are difficult to determine for which nervous system issue?
jenyasd209 [6]

Answer:

All of the above.      is correct

Explanation:

7 0
3 years ago
The process of genetic engineering may include either four or five steps. The diagram represents the five-step process. Which be
larisa [96]

The Answer Is A!!!!!!!!!!!

3 0
3 years ago
Read 2 more answers
A specialized fleshy stem used for food storage and reproduction is a _____.
notsponge [240]

Bulb is the answer because they are very short underground stem encased in thickened fleshy bulb scale.This scale help to store food


THANK YOU

MAKE ME THE BRAINEST!!


3 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which of the following can wear away the solid rock of a cliff over time? A. Ocean waves but not a small stream B. A small strea
ddd [48]

Answer:

it is B

Explanation:

5 0
3 years ago
Other questions:
  • Help solve this please I don't know how to do this
    8·2 answers
  • How do plants benefit from cellular respiration?
    13·2 answers
  • Genetically-modified organisms (GMOs) have included corn crops engineered to produce a natural pesticide to kill a certain insec
    9·1 answer
  • A scientist claimed that hemophilia is caused by a functional deficiency in Factor VIII. The evidence in the passage that would
    12·1 answer
  • ​a species that is found only on one island would be described as ____.
    7·1 answer
  • _____ currents are caused by temperature and density differences
    14·2 answers
  • State three features of the intensive system of keeping animals
    13·1 answer
  • 2. Is wastage of food also wastage of energy? Why do you think so?​
    11·2 answers
  • Suppose you have two identical solutions of glucose, A and B. The solutions are separated by a permeable membrane that will allo
    11·1 answer
  • I will give you brainliest<br> what does exercising do
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!