Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The chemical formula of aluminium nitrate is - Al(NO₃)₃
cation is Al³⁺
anion is NO₃⁻
One Al atom binds to three nitrate groups
the options given are
2. <span>It has three aluminum (Al) atoms
this is incorrect as there's only one Al atom
3. </span><span>It has one NO3 group.
this is incorrect as there are three nitrate groups
4. </span><span>It has nine nitrogen (N) atoms
there are only 3 N atoms therefore this too is incorrect
</span>therefore the correct answer is -
It has three NO₃<span> groups
</span>
Answer:
c. 77 %
Explanation:
Percent mass (% mass) of solute = mass of solute/mass of solution × 100
According to this question, a mountain dew solution weighing 300grams contains 231 g of sugar. This means that:
% mass of sugar = 231g/300g × 100
% mass of sugar = 0.77 × 100
% mass of sugar = 77%.
Answer:
Ok Hold up. I will answer after I think of question
Explanation:
Deutirium is the name of H-2 isotope
