1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
worty [1.4K]
3 years ago
6

What causes more pressure in the inner core?

Biology
1 answer:
stich3 [128]3 years ago
5 0
I believe it's the temperature in the core 
You might be interested in
Which type of sea animals are in ocean ..?
bagirrra123 [75]

Answer:

lol star fish, blow fish ,sword fish, shark, clown fish , octopus, jellyfish, squid, crab, sea horse

do you want me to continue?

Explanation:

7 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Meningo encephalitis is caused by​
DedPeter [7]

Meningitis is an inflammation of the membranes (meninges) surrounding your brain and spinal cord. ... Most cases of meningitis in the United States are caused by a viral infection, but bacterial, parasitic and fungal infections are other causes. Some cases of meningitis improve without treatment in a few weeks.

4 0
3 years ago
Read 2 more answers
What organelles help the nucleus do its job?
shepuryov [24]
Endoplasmic Reticulum. -- Transport System. Golgi Apparatus -- Delivery System. Lysosomes - Intracellular Digestion Centers. Ribosomes - Sites of Protein Synthesis. ENERGY RELATED ORGANELLES. Cytoskeleton - Support System. Related to Movement.
6 0
3 years ago
25. Review the graph below. Blue Jays and Robins do not interbreed. Assuming that both birds live in the same habitat, what woul
kolbaska11 [484]
We do quite often have mutt birds. (the correct name for such a mutt is a hybrid. <span>They are way more common than most people think, but unless you are a birdwatcher you probably wouldn’t even spot them. People often see an odd looking birds and simply think it’s a type they haven’t seen before, when in fact it is a hybrid of two well-known species. 

Having said that, for birds to hybridized they have to be fairly closely related to start with. Robins and blue jays are no more closely related than humans are to baboons. You wouldn’t expect a human and a baboon to be able to mate and produce babies would you? So no, robins and blue jays can’t interbreed.

However there are many different species of animal that CAN interbreed and produce offspring. But the different species need to be fairly closely related, far more closely than human and baboon… or a blue jay and a robin.

For example we can interbreed horses and donkeys to produce baby mules, and we can breed cattle and buffalo, or camels and llamas. And the same is true of birds. While blue jays can’t be bred with robins in the wild we quite frequently find mutt birds.

<span> Ducks are particularly noted for forming wild mutts and many if not all north American mallards for example are of mixed species ancestry.</span>


</span>
5 0
3 years ago
Other questions:
  • When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
    5·2 answers
  • Air pollution is best defined as ________.
    8·1 answer
  • The incidence of down's syndrome increases with the age of the mother. <br> a. True <br> b. False
    13·1 answer
  • A codon is a triplet base sequence in<br> A.tRNA<br> B.DNA<br> C.mRNA<br> D.rRNA
    15·1 answer
  • All nucleic acids contain a functional group that is also found in the subset of lipids that make up biological membranes. What
    8·1 answer
  • Transport proteins play a role in both?
    8·1 answer
  • A ____________ is an organism that produces offspring with the same trait as the parent.
    13·1 answer
  • What do statements are true about a punt square
    10·1 answer
  • What is an animal cell??
    6·1 answer
  • How are chromosomes classified?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!