1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
5

Which of the following is the most widely accepted method for limiting human population size?

Biology
2 answers:
Kruka [31]3 years ago
8 0
D - birth control is the most widely accepted method
Novosadov [1.4K]3 years ago
5 0

Answer:

d. birth control

Explanation:

You might be interested in
1. How many food chains make up the food web?
viva [34]

Answer:

A food web can be formed by more than one food chain, since the webs includes all possible interactions that can occur between individuals of different trophic levels.

Explanation:

Based on the scheme shown in the image

<h3>1. How many food chains make up the food web? </h3>

This food network is made up of three food chains

  1. <em>Plant → Bird → Snake</em>
  2. <em>Plant → Insect  → Bird → Snake</em>
  3. <em>Plant → insect → Frog → Snake</em>

Food webs often include several food chains, since they are due to the interaction between organisms at different trophic levels, which actually happens within an ecosystem.

<h3> 2. Which organism is an herbivore? </h3>

In this case, both the insect and the bird are herbivorous organisms, since they feed of the producer, which is the plant.

<h3> 3. Which organism is an autotroph? </h3>

The only autotrophic organism is the plant, since it is capable of manufacturing its nutrients from sunlight and inorganic matter.

<h3> 4. Which organism is a third-order heterotroph? To what trophic level does that organism belong? </h3>

The third order heterotroph is the snake, since it feeds on other animals.  The snake is a carnivore and can be a secondary or more commonly tertiary consumer, so it can be placed in the 3rd or 4th trophic level.

<h3> 5. Which organism is an omnivore? </h3>

According to the scheme proposed, the bird is omnivorous, since it feeds on both plants and insects.

<h3> 6. Which organisms belong to more than one food chain? </h3>

In this case, the plant, the insect, the bird and the snake are part of more than one food chain.

  1. <u><em>Plant → Bird → Snake</em></u>
  2. <u><em>Plant → Insect  → Bird → Snake</em></u>
  3. <u><em>Plant → insect</em></u><em> → Frog → </em><u><em>Snake</em></u>
<h3> 7. Which organism belongs to more than one trophic level? </h3>

The bird can be located in both the second and third trophic level, being a primary consumer —when it feeds on plants— or secondary, when it feeds on insects.

<h3> 8. What are decomposers? From which trophic levels are the organisms that decomposers feed on? </h3>

Decomposers are generally bacteria and fungi, organisms capable of degrading organic matter, thus enriching the soil. Decomposers can feed on any trophic level.

<h3> 9. What does a pyramid of energy show about the amount of energy available at different trophic levels of a food chain? </h3>

As the ascent of the pyramid occurs —or at the upper trophic level— the amount of energy available decreases. This is because from one trophic level to another only 10% of the energy can be used. If a plant has 5000 Kcal available, the herbivore that consumes it can only use 500 Kcal.

<h3> 10. Why do different trophic levels have different amounts of energy?</h3>

The main <u>reason for the difference in energy in each trophic level is that energy is lost in each one of them</u>, which the organisms use in their metabolism. A consequence of the metabolism is the loss of energy as heat, which is acquired by the environment.

8 0
3 years ago
Early land animals had gills as well as lungs. Please select the best answer from the choices provided T F
natka813 [3]
The answer is False.

Although, there are some evidence that suggests that species from million years ago possessed both gills and lungs. For example is the Acanthostega Gunnari, one of the oldest species discovered with four limbs. The creature is a salamander-like creature found in Greenland hundreds of million years ago. Although the specie can walk on land but the finding characterized the creature primarily as a fish.
6 0
3 years ago
Read 2 more answers
A chloroplast is an organelle inside of cells. True or False
Galina-37 [17]

The answer would be, True, A chloroplast is an organelle inside of cells.

3 0
3 years ago
Read 2 more answers
Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. I
Wewaii [24]

Answer:

D) The lac operon will function normally.

Explanation:

  • The promoter area can be described as the area that causes the transcription to initiate for a particular gene. Promoters may be near the genes from which they initiate transcription or they may display multiple scenes upstream.
  • The lock operon works normally because the promoter area can still enable transcription on many base pairs. Detects repression promoter and works normally.
  • so correct option is D) The lac operon will function normally.

4 0
3 years ago
On the pH scale, acids fall between ____ and bases fall between
skelet666 [1.2K]

Answer:

The correct answer is - O and 6.9; 7.1 and 14

Explanation:

A measuring scale that tells about the acidity or basicity or alkaline nature of a particular object or solution is possible with the help of a pH scale that measures how acidic or basic a solution or object is.

It ranges between 0 to 14. pH less than 7 or ranging from 0.0 to 6.9 is acidic and more than 7 or from 7.1 to 14.0 is basic or alkaline in nature. A measure of the relative amount of H+ ion and OH- ions in water is pH.

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A stairway has 6 steps. Is is a handrail required?
    13·1 answer
  • How do human activities have damaged the greenhouse effect?
    11·1 answer
  • Where is earth located in relation to the sun?
    12·1 answer
  • The lactose analog isopropyl-b-D-thio-galactoside (IPTG) is often used to regulate gene expression systems in bacteria. IPTG doe
    7·1 answer
  • An area with a large population of valuable ocean organisms is called a(n)
    14·2 answers
  • Which sequence accurately portrays the chronological order in which hominids evolved?. A. Homo habilis, Homo erectus, Australopi
    13·2 answers
  • What is phychologist​
    8·2 answers
  • Which model best represents the arrangement of atoms in a solid?
    14·1 answer
  • Que es solution hole​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!