1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
15

The ovaries are part of the endocrine system. TRUE or FALSE.

Biology
1 answer:
Arada [10]3 years ago
3 0
The ovaries are a part of the endocrine system, so its true.
You might be interested in
Describe how the food molecules that an organism eats can become part of that organism??
Whitepunk [10]

Answer:

food molecules become digested once there is a concentration gradient to drive diffusion, the nutrients need a path across the membrane. fats and fat soluble nutrients can move directly across the lipid membrane. water, gasses ane other very small molecules can diffuse through the pores of the cell.

3 0
2 years ago
ESP 7
nekit [7.7K]

1.pagsayaw 2.pagkanta 3.pagtula 4.pagrap. 1.pagguhit 2.pagsulat 3.pagbabasa 4.pagkalat ng balita. di ko na alam young Paano mo pinagyayaman sana makatulong

5 0
3 years ago
What directs and controls a animal cell activities?
DaniilM [7]
"Nucleus" (Genetic Material in it) <span>directs and controls a animal cell activities

Hope this helps!</span>
7 0
3 years ago
True or False: Only mutations which take place in the DNA of gametes (sex cells) will be passed down to offspring
alexgriva [62]
True, Only mutations which take place will be passed to offspring
7 0
3 years ago
Read 2 more answers
Typhoid fever, a disease that causes headaches, digestive upset, and a high fever, is caused by the bacterium Salmonella typhi.
devlian [24]

Answer:

Option D, Personal habits, such as hand washing, have greatly reduced contamination from bacteria.

Explanation:

Diseases like typhoid and cholera became pandemic a century ago because people at that time were not aware of the general hygiene and its impact on killing microbes.  

Majority of human diseases are caused by either bacteria or virus only when they ingest into the internal body system. The entry of microbes can be restricted by adopting healthy hygiene habits such as washing hands regularly with disinfectants, washing vegetable properly before cooking etc.

Such habits break the chain of contamination and hence prevent the disease from spreading.

Thus, option D is correct  

5 0
3 years ago
Other questions:
  • In most people which side of the brain is most involved in visual spatial activities?
    9·2 answers
  • A population of fruit bats faces a food shortage when the fruit trees they depend on for food begin to die from disease. What ty
    9·2 answers
  • Which label belongs in the area marked x?
    11·2 answers
  • The side chain of ________ has a pKa in the physiological pH range and is therefore often involved in proton transfer during enz
    5·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Place the following steps in the sharecropping process in the proper order.
    6·1 answer
  • How is adaption related to evolution
    10·1 answer
  • 8. What is the sex (gender) of this karyotype?
    12·2 answers
  • Which one of these would most likely be an intermediate species in an area that has been disturbed by a fire?
    11·1 answer
  • Points)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!