Photoreceptors<span>: The light sensing nerve cells (rods and cones) </span>located<span> in the retina. Pupil: The adjustable opening at the center of the iris through which light enters the</span>eye<span>. Retina: The light sensitive layer of tissue that lines the back of the </span>eye<span>.</span>
        
                    
             
        
        
        
Its defensive, warning coloration is bright colors. Such as poisonous dart frogs, they are brightly colored in order to warn predators they are poisonous 
        
                    
             
        
        
        
It’s called Igneous .......................
        
                    
             
        
        
        
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: