1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
11

Answer the following 2

Biology
2 answers:
artcher [175]3 years ago
3 0

The cell containing DNA is known as the nucleus. Chromosomes are located in the nucleus of every cell.

masya89 [10]3 years ago
3 0
<h2>Answer:</h2>
  1. <u>Eucariotic cells contain DNA</u>
  2. <u>All cells except reproductive cells contain chromosomes</u>
<h2>Explanation:</h2>

1) Eukaryotic cells are cells which contain a nucleus and organelles, and are packed up by a plasma membrane. Examples of organisms that have eukaryotic cells are protozoa, fungi, plants and animals. All of these types of cells contain DNA.Genes are composed of DNA, and it is predicted that there are over 3 billion basepairs in the human genome.

2) All the human cells have 23 pairs of chromosomes which are 22 pairs of autosomes and one pair of sex chromosomes, which means a total of 46 per cell. The only human cells that do not contain pairs of chromosomes are reproductive cells, or gametes. These cells just one copy of each chromosome.

You might be interested in
Where are the photoreceptors located inside a human eye
katovenus [111]
Photoreceptors<span>: The light sensing nerve cells (rods and cones) </span>located<span> in the retina. Pupil: The adjustable opening at the center of the iris through which light enters the</span>eye<span>. Retina: The light sensitive layer of tissue that lines the back of the </span>eye<span>.</span>
8 0
3 years ago
Read 2 more answers
Warning coloration is an example of what kind of behavior?
damaskus [11]
Its defensive, warning coloration is bright colors. Such as poisonous dart frogs, they are brightly colored in order to warn predators they are poisonous 
7 0
3 years ago
Read 2 more answers
Short answer question::<br><br> A rock formation that soil comes from is called ___
choli [55]
It’s called Igneous .......................
3 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Cartoon and movie characters such as Wolverine, Mystique and Storm lead to the notion that genetic
elena-14-01-66 [18.8K]

Answer: A

Explanation:

7 0
3 years ago
Other questions:
  • Heyo ooooo oo oml<br> oppiesopp
    12·2 answers
  • What step happens first in translation
    8·2 answers
  • Which of the following describes how polluted water sources would most likely affect one’s personal health?
    5·2 answers
  • A gene for eye color is located very close to a gene for coat color in a certain organism. How likely is it that a crossover wil
    6·1 answer
  • Which type of wave is a secondary wave?<br> body<br> surface<br> transverse<br> subduction
    5·2 answers
  • The bacterium, E. coli prefer to consume glucose. If, however, there is no glucose present, they will utilize lactose as an ener
    8·1 answer
  • Please Help!
    14·2 answers
  • Positively charged sodium ions transport electrical impulses in the nervous system. Which subatomic particle does sodium lose to
    7·1 answer
  • Match the scenario with the theory of motivation that is being described. Some will be used more than once.
    15·2 answers
  • How many TOTAL valence electrons are in the molecule H 2 O ? 8,2,6,1
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!