1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlladinOne [14]
3 years ago
6

A study has shown that Scotland's river otter population is increasing after falling

Biology
1 answer:
leva [86]3 years ago
3 0

Answer:

An otter's den is called a holt or couch.

Explanation: Otters are found almost all over the world and in many wet habitats, such freshwater rivers, lakes, oceans, coastlines and marshes. Most otters live in dens — built by other animals, such as beavers — that are dug into the ground that have many channels and dry inner chambers

You might be interested in
Why do some birds have bright colors while others look more camouflaged
Alika [10]
Male Birds are usually the colorful birds to attract mates while females are camouflaged to protect their eggs/hatchlings. Ground birds need to be camouflaged because they are easy prey and they have their nests on the ground.
7 0
3 years ago
According to the results, what is the pH of the
bearhunter [10]

Answer:

about 7 which is neutral

7 0
2 years ago
A student is learning about the functions of leukocytes. What statements about these cells are correct
Ksivusya [100]
<h2>What are leukocytes?</h2>

Leukocytes are colorless cells that circulate in the blood and belongs to the body's immune system and helps the body fight infections and other diseases.

<h2>What is their function?</h2>

Leukocytes are responsible for fighting other diseases and protecting your body from infections. Since they are part of the immune system, leukocytes circulate your blood and help cure injuries or illness.

8 0
3 years ago
When chiasmata can first be seen in cells using a microscope, which of the following processes has most likely occurred? the sep
Elina [12.6K]

When chiasmata can first be seen in cells using a microscope, the following processes has most likely occurred in prophase I.

<h3>When chiasmata can first be seen in cells using a microscope?</h3>

Recombination can occur at any two chromatids within this tetrad structure.

Crossovers between homologous chromatids can be visualized in structures known as chiasmata, which appear late in prophase I.

Thus, option "C" is correct, Prophase I.

To learn more about prophase I click here:

brainly.com/question/4137695

#SPJ1

3 0
2 years ago
All viruses are made of proteins and
SCORPION-xisa [38]

Answer:c

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Typical United States weather patterns show the continental polar air mass moving south toward the Gulf of Mexico. Why does this
    13·2 answers
  • During the _____ stage of the general adaptation syndrome, catecholamines are released by the adrenal medulla. intense arousal o
    8·1 answer
  • Once rock reaches a depth of about _____, it may melt
    9·1 answer
  • What are the 3 major functional units of a gene and what are their functions ?
    6·1 answer
  • How many babies were born on ellis island
    5·2 answers
  • A 70-year-old man has a 90% blockage at the origin of the
    5·2 answers
  • What is the function of interstitial fluid?
    12·2 answers
  • How does primary protein structure affect the function of protein enzymes?
    7·1 answer
  • The hay included as part of the culture medium provided a food source for bacteria. Bacteria are a good food source for some typ
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!