1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zinaida [17]
4 years ago
11

How are predation and competition essential for maintaining a thriving ecosystem?

Biology
1 answer:
Elis [28]4 years ago
8 0

Answer:

<u>Both of these are necessary to maintain overpopulation of any species in an ecosystem.</u>

Explanation:

  • Predation is an act in which one organism eats another organism present in the ecosystem.

  • The one eaten is called prey, while the dominant organism is called Predator.

  • Since an ecosystem is made up of many organisms along with the natural resources present in it.

  • This gives rise to different species competing against one another.

  • If one of these species is at a certain advantage, their population will rise uncontrollably hence to prevent this a predator plays a major role.

  • On the other hand, competition is a term which describes the harm caused to two different organisms.

  • This is due to the limited number of natural resources like food, water or shelter etc.

  • Organisms who are less likely to adapt according to the changing environment ultimately die.

  • For example, Plant roots over time lessen the amount of nitrogen present in the soil, causing the neighboring plant to die.
You might be interested in
What is a characteristic shared by both predators and parasites
Pani-rosa [81]
They both share the characteristic of capturing prey for food.  
4 0
3 years ago
Why do some birds have bright colors while others look more camouflaged
Alika [10]
Male Birds are usually the colorful birds to attract mates while females are camouflaged to protect their eggs/hatchlings. Ground birds need to be camouflaged because they are easy prey and they have their nests on the ground.
7 0
3 years ago
You are asked to calculate an object's velocity. In order to do so you must know the object's
vfiekz [6]

Answer:

You must know the object's distance and time of acceleration

Explanation:

5 0
3 years ago
How are bacteria able to regulate their genes by two types of operons?
Aleks04 [339]

Operons are the functional units of transcription and genetic regulation. These are found in bacteria and their viruses where genes coding for functionally related proteins are grouped along the DNA.

The two types of operons are- inducible and repressible.

They regulate the genes as in negative inducible operons, a regulatory repressor protein is bound to the operator. It prevents the transcription of the genes on the operon. If positive inducer is present, it binds to the repressor and changes its conformation so it is unable to bind to the operator.


5 0
3 years ago
Name three ways mineral exploration is conducted:
Artemon [7]
Exploration, mining and processing
4 0
3 years ago
Other questions:
  • What is the function of a grasshopper's rectum
    6·2 answers
  • Kristan has an outdoor garden where she grows geraniums. One day, she decides to try to grow a geranium inside her house. After
    11·2 answers
  • The bonds formed when electrons are shared is called a(n)?
    6·2 answers
  • How do fungi affect homeostasis in other organisms and the environment?
    13·1 answer
  • What is the LARGEST mammal in the world?
    14·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • __________ provides a way that a version of a gene found on one chromosome can move onto the other chromosome.
    9·2 answers
  • How do you define light cycle?​
    12·1 answer
  • How would an increase in nest sites affect a population of pigeons?
    15·1 answer
  • List Characteristics of ALL LIVING THINGS <br>​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!