1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
8

A stroke victim has great difficulty moving his right hand and right leg. He also has trouble speaking. Which of his cerebral he

mispheres is most likely to have been damaged
Biology
1 answer:
Fofino [41]3 years ago
6 0

Answer:

The correct answer is left cerebral hemisphere.

Explanation:

The left cerebral hemisphere of the brain is accountable for the motor control of the right side of the body, for sensory stimulus from the body’s right side, for analysis and calculations, for the speech, comprehension, and language, for the recognition of letters, words, and numbers, and for time and sequencing.  

The left cerebral hemisphere is accountable for the processing of the sensory information and motor information for the body’s right side. Thus, as left cerebral hemisphere monitors the movement of the body's right side, so, based on the extremity of the stroke, which may result in motor skill impairment or functional loss of the right side of the body, shows that the left side of the brain has got affected.  

You might be interested in
06.01 formation of the solar system
Zina [86]

Answer:

what is the question

Explanation:

8 0
3 years ago
Some bed bugs had mutations in their genetic code which allowed them to survive the chemical pesticide and they produced chemica
Salsk061 [2.6K]

Answer:

Random mutations led to evolution of pesticide resistance genes in bed bugs.

Explanation:

Random mutations in genome of bed bug imparted them the pesticide resistance. Since the bed bugs having the mutation of pesticide resistance were able to survive under presence of pesticides, this variation was favored by natural selection. The bugs with pesticide resistance transmitted this trait to their progeny. In time, the bed bug population consisted of most of the bugs having the pesticide resistance.

8 0
3 years ago
A deep water island of marine debris is located directly in the migratory path of a pod of humpback whales. How would this affec
Mashutka [201]

The carrying capacity of a biological organism in the surrounding refers to the maximum size of the population of the organism that the environment can maintain indeterminately, given the habitat, food, water, and other essential requirements in the environment.  

When a deep water island of marine debris is situated directly in the migratory path of a pod of humpback whales, then the carrying capacity for the region would be negotiated and the populations of whale will suffer.  


4 0
3 years ago
Pls help fast
Nimfa-mama [501]
The answer is Tree because it is a plant which means it has cellulose tubes.

Hope this helps!!
7 0
3 years ago
2. What must be done to carbon dioxide gas to change it to a solid?.
photoshop1234 [79]

Answer:

2. What must be done to carbon dioxide gas to change it to a solid?.

Carbon dioxide is a gas by using a metal to solidify it

3. Which is colder, dry ice or carbon dioxide gas?

Carbondioxide gas

If dry ice is placed in water, we see bubbles rise.

4. These bubbles are made of gaseous substance in the  gaseous state.

5. What happens to the size of the dry ice as the bubbling goes on?

the size of the dry ice reduces as a result of conversion of solid to liquid form

Explanation:

8 0
3 years ago
Other questions:
  • Please I need help with questions 40-45 and it’s very hard and I’m struggling with it and if you need to see the picture big the
    12·1 answer
  • There are several cell types found in the plasma of our blood. which cell type is essential for forming clots that prevent us fr
    13·1 answer
  • A few years after a major oil spill, which area is most fragile in terms of biodiversity?
    8·1 answer
  • Pioneered early research demonstrating that an association between a neutral stimulus and an automatic behavior could be learned
    13·1 answer
  • There are several disadvantages for asexual reproduction, what would be an advantage
    7·1 answer
  • It is best to say that most human sources of air pollution result from _______.
    11·2 answers
  • Please help <br><br> Fast. HELP
    12·2 answers
  • At concentrations of 0.1-1 g/mL. colchicine, a natural plant product, can cause the mitotic arrest of dividing cells at metaphas
    13·1 answer
  • Name the phase:<br>Hint: Chromosomes are moving apart.​
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!