1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
14

How much is 7/9 of 3/14?

Mathematics
2 answers:
mash [69]3 years ago
5 0
OF is another way to say times or divided by, so we have 7/9*3/14=21/126=1/6.
34kurt3 years ago
4 0
7/9 of 3/14 is 1/6.   

Tell me if I'm wrong.  

Hope this helps :)

You might be interested in
Type the expressions as radicals. q ^ (3/2)
melisa1 [442]

Answer:

\sqrt{q^3}

Step-by-step explanation:

5 0
3 years ago
Juan wrapped 2 presents every 16 hours. At that rate, how long, in
maks197457 [2]

Answer:

Since it took Juan 16 hours to wrap 2 presents, it will take Juan 32 hours.

1 present- 8 hours

2 present- 16 hours

3 present- 24 hours

4 present- 32 hours

5 0
2 years ago
Read 2 more answers
What is the y-value of sin(x) when x= -180°?
Andreyy89

In trigonometry, we start from the point (1,0), so this is the 0-degree point. Then, we start rotating counter clockwise along the unit circle.

Note that rotating 180 or -180 degrees is actually the same, because you travel half the circumference clockwise or counter clockwise. In both cases, you start from the rightmost point of the circle, (1,0), and arrive at the leftmost point, (-1,0).

Now, for every point (x,y) on the unit circle, given by a certain angle \alpha, we have

\cos(\alpha)=x,\quad \sin(\alpha)=y

So, in this case, the angle of -180 is associated with the point (-1,0), and thus we have

\sin(-180)=0

8 0
3 years ago
Just number 7 would be fine but if you could also number 8 would help a lot​
BlackZzzverrR [31]

Answer:

7. r = -5

8. x = -1

General Formulas and Concepts:

<u>Pre-Algebra</u>

Order of Operations: BPEMDAS

  1. Brackets
  2. Parenthesis
  3. Exponents
  4. Multiplication
  5. Division
  6. Addition
  7. Subtraction
  • Left to Right

Equality Properties

Step-by-step explanation:

<u>Step 1: Define</u>

r + 2 - 8r = -3 - 8r

<u>Step 2: Solve for </u><em><u>r</u></em>

  1. Combine like terms:                    -7r + 2 = -3 - 8r
  2. Add 8r to both sides:                   r + 2 = -3
  3. Subtract 2 on both sides:            r = -5

<u>Step 3: Check</u>

<em>Plug in r into the original equation to verify it's a solution.</em>

  1. Substitute in <em>r</em>:                    -5 + 2 - 8(-5) = -3 - 8(-5)
  2. Multiply:                              -5 + 2 + 40 = -3 + 40
  3. Add:                                    -3 + 40 = -3 + 40
  4. Add:                                    37 = 37

Here we see that 37 does indeed equal 37.

∴ r = -5 is a solution of the equation.

<u>Step 4: Define equation</u>

-4x = x + 5

<u>Step 5: Solve for </u><em><u>x</u></em>

  1. Subtract <em>x</em> on both sides:                    -5x = 5
  2. Divide -5 on both sides:                      x = -1

<u>Step 6: Check</u>

<em>Plug in x into the original equation to verify it's a solution.</em>

  1. Substitute in <em>x</em>:                    -4(-1) = -1 + 5
  2. Multiply:                               4 = -1 + 5
  3. Add:                                     4 = 4

Here we see that 4 does indeed equal 4.

∴ x = -1 is a solution of the equation.

8 0
3 years ago
Read 2 more answers
Given the measures a = 10, b = 40, and A = 30°, how many triangles can possibly be formed?
arlik [135]

Answer:

no triangle can be formed with the given values (i.e 0 triangle).

Step-by-step explanation:

Given;

length of side a, = 10

length of side b, = 40

angle A, = 30°

Apply sine rule to determine the angle of the second side (B);

\frac{sin \ A}{a} = \frac{sin \ B}{b} \\\\\frac{sin \ 30^0}{10} = \frac{sin \ B}{40}\\\\sin \ B = 40(\frac{0.5}{10} )\\\\sin \ B = 2

The maximum sine function is 1, there is no sine function that will be equal to 2, so there is no triangle that can be formed with the given values.

8 0
3 years ago
Other questions:
  • How to find the answer ?
    9·1 answer
  • The perimeter of a rectangular vegetable patch is 32 meters. the area is 63 square meters. what are the dimensions of the vegeta
    14·1 answer
  • Here are the test scores for 8 students in Mr. P's class. 58, 82, 43, 73, 90, 37, 62, 75 What is the percentage of these test sc
    10·1 answer
  • Please help me with these and explain by steps how to do
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Rewrite each of the following statements in the form "∀ _____ x, _____."
    7·1 answer
  • Can someone help me. Please.<br> Algebra.
    10·1 answer
  • How many solutions does the following system have? Please explain your answer in 1-2 sentences.
    11·1 answer
  • Randy is 23 years old and wants to have saved a total of $1,000,000 by the time he’s 65. He is willing to set up a direct deposi
    7·1 answer
  • Clear parenthesis and combine like terms.<br> −2( − 4) − 3( + 2)<br> Show all the work.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!