All categories

3 years ago

In the reaction represented by the equation 2al2o3 ® 4al + 3o2, what is the mole ratio of the products aluminum and oxygen?

1 answer:

4 0

Answer:
4 : 3

Explanation:
The balanced chemical equation is given as follows:
2Al₂O₃ ..............> 4Al + 3O₂
Now, from this equation we can note that:
For every 4 moles of aluminum moles produced, corresponding 3 oxygen moles are produced.
This means that the ratio between the formation of aluminum to the formation of oxygen moles is 4:3

Hope this helps :)

You might be interested in

PLEASE HELP I WILL REWARD BRAINLIEST !!!

Travka [436]

Googles Definition of Convection: <span>the movement caused within a fluid by the tendency of hotter and therefore less dense material to rise, and colder, denser material to sink under the influence of gravity, which consequently results in transfer of heat.

</span>

4 0

3 years ago

The water bottle contains 575 grams of water at 80°C. The water eventually cools to

Jet001 [13]

Answer:

–23000 Calories.

NOTE : The negative sign indicates that heat has been loss to the student back.

Explanation:

The following data were obtained from the question:

Mass (M) of water = 575 g

Initial temperature (T1) = 80 °C

Final temperature (T2) = 40 °C

Heat (Q) transferred =.?

Next, we shall determine the change in temperature (ΔT).

This is illustrated below:

Initial temperature (T1) = 80 °C

Final temperature (T2) = 40 °C

Change in temperature (ΔT) =?

Change in temperature (ΔT) = T2 – T1

Change in temperature (ΔT) = 40 – 80

Change in temperature (ΔT) = –40°C

Finally, we shall determine the heat transferred. This can be obtained as follow:

Mass (M) of water = 575 g

Change in temperature (ΔT) = –40°C

Specific heat capacity (C) of water = 1 Cal/g°C

Heat (Q) transferred =.?

Q = MCΔT

Q = 575 × 1 × –40

Q = –23000 Calories

NOTE : The negative sign indicates that heat has been loss to the student back.

8 0

3 years ago

Please help me, please i really need it :)

Mekhanik [1.2K]

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

4 0

2 years ago

Hi can you slove this please. ..

Crank

Answer : The balanced chemical equation will be:

(i) $2K+H_2SO_4\rightarrow K_2SO_4+H_2$

(ii) $Mg(OH)_2+Zn\rightarrow Zn(OH)_2+Mg$

Explanation :

Balanced chemical equation : It is defined as the equation in which total number of individual atoms on the reactant side is equal to the total number of individual atoms on product side.

Part (i):

The balanced chemical equation will be:

$2K+H_2SO_4\rightarrow K_2SO_4+H_2$

This reaction is a single displacement reaction in which most reactive element (potassium) displaces the least reactive element (hydrogen) form their solution.

Part (ii):

The balanced chemical equation will be:

$Mg(OH)_2+Zn\rightarrow Zn(OH)_2+Mg$

This reaction is a single displacement reaction in which most reactive element (zinc) displaces the least reactive element (magnesium) form their solution.

7 0

3 years ago

Two reasons why a scientist might want to study the DNA of strawberries?

fenix001 [56]

1.To discover the chromosomal state of the species in order to advance on Knowledge of the species Evolutionary process.
2. To form a hybrid of the species.

3 0

2 years ago

Read 2 more answers