1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
6

A ____________ is a testable possible explanation, while a ___________ is an explanation that has been tested extensively. A) th

eory, law B) hypothesis, law C) hypothesis, theory D) theroy, hypothesis
Biology
2 answers:
viva [34]3 years ago
4 0

A hypothesis is a testable possible explanation, while a theory is an explanation that has been tested extensively.

If you need to learn more and remember about this stuff better, watch the Amoeba Sister's <em>Casual and Scientific Use of "Theory" and "Law"</em>. Trust me, it helps!

:)I hope I answered your question well!:)


Mashutka [201]3 years ago
4 0

Answer:

hypothesis, theory

Explanation:

You might be interested in
The hypothesis that germs desease is theory Before many scientists believed in the idea spontaneres the appearance of organists
il63 [147K]

Explanation:

The Germ Theory of Disease  indicates that microbes are the causal agents in human disease.  In modern healthcare, Germ Theory has led to a breakthrough in the treatment of infectious diseases with antibiotics such as penicillin, and the prevention of disease outbreaks through proper sanitation and vaccination.

Further  Explanation:

Biology's unifying principle states that cells are the basic units of biological organisms. Cells sharing a similar origin, group together in the body to form tissues; these typically share physical features and are arranged in regular patterns. All living things, grow, respire, reproduce etc. these processes are carried out by cells, which are thus integral to their survival.

Before the discovery of cells by Robert Hooke in 1665 with a simple microscope, many scientists had long believed that life rose spontaneously over extended periods of time. Circa 1668 Francesco Redi, challenged the idea of spontaneous generation of maggots from rotting meat by placing meat in various sealed open, partially sealed and sealed containers. Sealed containers did not show the presence of maggots, and he theorized that these were likely from eggs laid on the meat by flies. This was the development of the theory disproving abiogenesis (cells arise from other living cells); this eventually proved the unifying principle we know today.

Cell theory states that living things are comprised of cells, as their smallest units capable of functioning. Microscopy helps to prove this, as cells and their varying components can readily be seen, observed and later classified.

Learn more about cellular life at brainly.com/question/11259903

Learn more about tissue types at brainly.com/question/8487952

#LearnWithBrainly

4 0
3 years ago
]
Feliz [49]

Answer:false

Explanation:

5 0
3 years ago
Read 2 more answers
How do basaltic rocks differ from granitic rocks?
DanielleElmas [232]

Answer:

ddasd

Explanation:

5 0
3 years ago
1.John has very good body co-ordination to become a free style dancer. Which system is involved in carrying out such co-ordinati
igor_vitrenko [27]

Answer:

the answer would be muscular coodination

and the cardiac muscles do not get rest

6 0
4 years ago
What is the role of the effector in a feedback loop?
aleksklad [387]
The effector in a negative feedback system acts to counter any changes made to a particular property. If it were positive feedback, it would amplify the change and make it more extreme
5 0
4 years ago
Other questions:
  • What is the difference between hydrophobic and hydrophilic molecules
    10·1 answer
  • Marvin blows up a balloon but lets go of it. The air inside is released and the balloon goes up into the air. What best describe
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Scott has to memorize 25 words.He had memorized 15 out of 25 words.What will the answer's be in a fraction?
    13·2 answers
  • What do you notice about the Moon’s orbit?
    5·1 answer
  • What is mitosis? help pls !!
    10·2 answers
  • HElPP MEE PLEEAAASEEEE :( ill mark u brainliest- thankyou so muuch
    11·1 answer
  • HELP ME PLEASE Question 3 of 10
    15·1 answer
  • How can pollution travel from one resource to another? Complete the table by describing one example for each set of resources.
    8·1 answer
  • Why is it important to know the average mutation rate when using DNA comparisons to determine
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!