1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
5

Elements can be represented by chemical symbols. Which of the following is the correct way to write the chemical symbol for sodi

um?
Chemistry
1 answer:
mixer [17]3 years ago
4 0

Na

hope this helps :)

You might be interested in
What mass, in grams, of NaNo, is needed to make 6.24 Liters of a 0.500 M solution?
mafiozo [28]

Answer:

that hared ldkdjjjdjjdjdjj

3 0
3 years ago
When the ground becomes saturated in a rain storm and the excess cannot be soaked up, the water will travel along the ground unt
dalvyx [7]

The answer is surface water

8 0
3 years ago
Read 2 more answers
Write a word equation for the overall reaction that occurred in the baggie. The reactants are sodium bicarbonate, carbon dioxide
Fynjy0 [20]

Answer:

Explanation:

In a baggie, sodium bicarbonate is decomposed into sodium carbonate and carbondioxie and water is given off as gases:

6 0
4 years ago
At the start of the _________, about 10,000 years ago, humans began planting crops and domesticating animals.
Alex777 [14]
I think the Neolithic Revolution is the correct answer
5 0
3 years ago
A photocopier is making reduced copies of a photo that measures 25 centimeters in height. The height of the first copy is​ 80% o
Marat540 [252]

Answer:The height of First Copy is 20 cm.

Step-by-step explanation:

Given:

Original Height = 25 cm

First copy is reduce to 80% of Original height.

Therefore to find the height of first copy can be find out by multiplying 80 with original height and then dividing by 100.

∴ Height of First Copy =

Hence Height of first copy is 20 cm

Now Another copy is reduce to 85% of First Copy.

Therefore to find the height of another copy can be find out by multiplying 85 with first copy height and then dividing by 100.

∴ Height of Another Copy =

Hence Height of Another copy is 17 cm

Explanation:

8 0
3 years ago
Other questions:
  • Determine how many moles of hydrogen are needed to produce 50 grams of ammonia.
    10·1 answer
  • . What is a carbonyl group? Draw the carbonyl groups that are characteristic of aldehydes, ketones, carboxylic acids, and esters
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A tropical cyclone is a weather event that causes strong winds and heavy rainfall. What is the source of energy for a tropical c
    6·1 answer
  • 3Co2 (aq) 6NO3(aq) 6Na (aq) 2PO43–(aq) → Co3(PO4)2(s) 6Na (aq) 6NO3(aq) Identify the net ionic equation for this reaction.
    12·1 answer
  • How do systems impact creation?
    5·1 answer
  • If 8.500 g CH is burned and the heat produced from the burning is added to 5691 g of water at 21 °C, what is the final
    11·1 answer
  • What is the mass of 8.87 x 10^24 atoms of carbon?<br><br> PLEASE HELP!!
    7·1 answer
  • What type of change is sugar dissolving in water physical or chemical
    10·1 answer
  • What is the purpose of the cell wall?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!