Answer: 92.66L. Explanation: Applying ideal gas equation considering the gas inside the balloon to be ideal, to get the new volume,.
Explanation: Hope This Helps! ^^
<em>From: Kenji</em>
<em></em>
<em>#LearnWithBrainly</em>
<em></em>
<em>~Have A Nice Day!~ </em>
<em></em>
<em></em>
<em></em>
<em></em>
<em></em>
<em></em>
<em></em>
<em></em>
<em>Also....</em>
<em></em>
<em></em>
<em></em>
<em>It's nice to see you cory :^</em>
Magnesium has 12 electrons.........which wud mean that in the 1st energy level(n=1) there r 2 electrons, in the 2nd energy level(n=2) there r 8 electrons and in the 3rd energy level(n=3) there r 2 electrons.......its simple......use the formula 2n^2 where n= 1,2,3,......
so the electron configuration of Magnesium in 2,8,2..................or more precisely 1s2, 2s2, 2p6, 3s2
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer is B. both need food and air
-3x + 3(2x - 6) = 6
-3x +6x - 18 = 6
3x - 18 = 6
3x = 6 + 18
3x = 24
x = 8
hope this helped, blessing! :)
