1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
12

Groundwater _____. A)exists above the earth's surface B)is impossible to pollute C)forms when precipitation seeps into the soil

D)is not a usable water source for humans
Biology
2 answers:
kirill [66]3 years ago
8 0

Answer: C

Explanation: It isn't impossible to pollute and it is a usable water source AKA wells

svp [43]3 years ago
8 0
Answer:
C.
Explanation:
Groundwater as it’s name suggests is water that is under the ground, so just like is said in answer C. Precipitation seeping into the soil would make the most sense.
You might be interested in
The fatal human illness called Huntington disease is caused by a dominant mutant allele. Calculate the probability that a couple
BaLLatris [955]

Answer: There is a 50% chance that the offspring will inherit Huntington's disease

Explanation:

Huntington's disease is expressed by a dominant allele.

Since the father is heterozygous for Huntington's disease, his genotype would be as follows:Hh

Even though he carries a normal allele, the dominant allele is disease causing and thus masks the effects of the normal allele, therefore he expresses the disease.

The mother does not have Huntington's because she is homozygous recessive, in other words, she carries 2 copies of the normal alleles.with the genotype hh.

If you do a punnet square, and you cross the mother and father, the following genotypes can be produced:

Hh, Hh, hh, hh

Therefore, there's a 50% chance that the offspring will inherit the disease causing allele and 50% chance that the offspring will not inherit it.

7 0
3 years ago
When non-nerve cells become involved in response to signals which type of receptors goes into action
mamaluj [8]
Your answer would be: enzyme-linked receptor.
4 0
3 years ago
A runner produced hypotonic sweat while running a marathon in hot weather. Aner the race, he drank large volumes of water. As a
choli [55]

Answer:

Option B) Swell

Explanation:

When runner was running he was sweating which results in loss of water from cells and cells become shrink. But at the end of marathon when he drink water his cells will gain water and store it, which results in swallowing of cells.

4 0
3 years ago
Read 2 more answers
Examine the illustration of the HIV virus. What part of the HIV virus serves to protect the nucleic acid core?
Fed [463]
The correct answer is A: Capsid. 
5 0
3 years ago
Read 2 more answers
What does the “ rainbow in the sky” symbolize
Marianna [84]
The end of a difficult time (aka hope )
5 0
3 years ago
Read 2 more answers
Other questions:
  • I am still in 9th i need to make a simple model of a mitochondria any suggestions?
    8·2 answers
  • Why does molting occur?
    6·1 answer
  • A group of environmental scientists wants to study the impact of population growth on the environment. Which discipline will con
    15·2 answers
  • Minerals enter roots through the process of
    11·1 answer
  • both algae and the fungus are benefited from their relationship in a lichen. this relationship is one of
    7·2 answers
  • What aspects of the genome can and cannot be determined through karyrotyping( sorting chromosomes)
    9·1 answer
  • DNA is a type of<br> A. lipid<br> B. nucleic acid<br><br> C. starch<br> D. protein
    12·2 answers
  • The carbon cycle is based on CO2. Therefore, photosynthesis is the opposite of
    15·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which is the best hypothesis for the extinction of the dinosaurs at the end of the Cretaceous period?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!