Answer:
the answer to that question is
fungi
Answer:
C
Explanation:
Many people of many different statuses, genders, races, and time periods have established our scientific knowledge of today.
Answer:the component materials and their arrangement
Explanation:
Bone are important for movement in animals.bones is made up of 15% water,30% collagen fibres and 55% mineral salts..bone cells are widely separated. The Collagen makes bones soft and flexible. Mineral salts makes it fragile and strong.
The osteogenic cells builds the bones and the osteoclasts breaks down older bone tissue, in order to keep the body strong.
Spongy bones contains tiny spicules that helps in strength.
It also reduces the weight of the bones .
The cells of Compact bones are arranged in the direction of stress to keep the bone strong.
They are constantly changing throughout life
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
No not if there are factory or houses that causes stuff like global warming
