1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
4 years ago
13

Which description correctly characterizes the acidity or basicity of a solution? The higher the pH is, the more the hydroxide io

n concentration decreases and the more acidic the solution becomes. The higher the pH is, the more the hydroxide ion concentration increases and the more basic the solution becomes. The lower the pH is, the more the hydronium ion concentration decreases and the more acidic the solution becomes. The lower the pH is, the more the hydronium ion concentration increases and the more basic the solution becomes.
Chemistry
1 answer:
azamat4 years ago
3 0

Answer:

The higher the pH is, the more the hydroxide ion concentration increases and the more basic the solution becomes.

Explanation:

  • When the pH of a solution is less than 7, then solution is called acidic and as the pH decreases the concentration of Hydronium ion increases.
  • When the pH is about 7, then the  solution is said to be neutral. On the other hand, when  the pH is greater than 7, the solution is is said to be basic and as the pH increases the concentration of Hydroxide ions increases.
  • Therefore, An acidic solution has a higher concentration of hydrogen ions compared to the concentration of hydroxide ions.
You might be interested in
Fog forms when a water vapor changes to the___ state of matter?
Bumek [7]

Answer:

Gas

Explanation:

7 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
4 years ago
Acidic<br> Basic<br> Neutral
lana66690 [7]
The answer is acidic
8 0
3 years ago
Why Aluminium Oxide has higher melting point than Alumunium Chloride? Try to mentioned about ionic compound.
Sidana [21]

Answer:

Aluminium oxide has higher melting point than aluminium chloride because there nay be some impurities in the oxide which affects the intermolecular force of attraction

4 0
4 years ago
Which of the following is a balanced equation for the reaction described below?
mylen [45]
The correct answer is b
5 0
3 years ago
Other questions:
  • The ionization constant (Ka) of HF is 6.7 X 10 ^-4. Which of the following is true in a 0.1 M solution of this acid?
    14·2 answers
  • How many atoms are in a sample of 72.8 grams calcium ?
    13·1 answer
  • A gas has a pressure of 2.31 atm and occupies
    8·1 answer
  • In the simulation, open the micro mode, then select solutions indicated below from the dropdown above the beaker in the simulati
    9·1 answer
  • In which of the following is number of electrons the ion contains given correctly? A. H+ has 1 electron. B. Br- has 34 electrons
    12·2 answers
  • 2. Calculate the density of a rock that has a mass of 21.58 grams and causes the water in a
    5·1 answer
  • Find the density of a cube volume of 150 cm and a mass of 100g
    8·1 answer
  • Heat that flows by conduction is the transfer of thermal energy between substances in contact. What must occur for this to happe
    12·1 answer
  • Can someone please help? This is really hard!!
    6·1 answer
  • A cylinder at left with balls evenly spaced throughout the cylinder with an arrow leading to a cylinder at right with balls stac
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!