1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
7

Del proceso digestivo de los peces ¿cuales so las variables dependientes y independientes?

Biology
1 answer:
Whitepunk [10]3 years ago
5 0

Answer:

Explanation:

Descripción Las variables dependientes e independientes son variables en modelos matemáticos, modelos estadísticos y ciencias experimentales. Las variables independientes son entradas controladas. Las variables dependientes representan la salida o el resultado resultante de alterar estas entradas.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Match the time period with the correct layer of fossils (mya = millions of years ago). ITEM BANK: Move to Bottom 175 mya250 mya4
Marrrta [24]

Answer:

0 mya, 175mya, 250mya, 400mya

Explanation:

The substance which highest million year ago should be more in-depth in the soil hence 400mpa should occupy the highest depth below the ground.

3 0
3 years ago
Biology students used raw eggs in an experiment on tonicity and osmosis. The students put their eggs into vinegar to remove the
jolli1 [7]

The vinegar had turned the whites of the egg clear, so you can see in it.

Hope this helped :)

4 0
3 years ago
Read 2 more answers
The steps of the DNA ladder are made of _____.
stepan [7]
C paired nitrogen bases. hope i help don't forget to go subscribe to king kevin on youtube its my channel i have 840 subscribers plz go subscribe and be active thank you.
5 0
4 years ago
Which of the following is NOT a reason for asexual reproduction in somatic cells? A growth B replacement of dead cells С repair
Anika [276]

Answer:

D. Making gametes technically isnt asexual reproduction because the offspring arent exact copies.

Explanation:

Mitosis is what replaces dead/ dying cells and repair injuries

8 0
3 years ago
Other questions:
  • One person can carry a 4 day supply of food and water for a trip
    7·1 answer
  • Which planet is full with methane clouds?
    6·2 answers
  • Please help which is this 30 points
    7·2 answers
  • I need a slogan for RNA
    12·2 answers
  • What is synsarcosis? list the muscle of synsarcosis.
    15·2 answers
  • A scientist is studying a cell from an unidentified organism. Which of these observations of the cell provide evidence for class
    14·1 answer
  • Which among these is a biotic factor?
    15·2 answers
  • what is a promoter? a.)binding site for DNA polymerase. b.) binding site for RNA polymerase. c.)a start signal for replication d
    11·2 answers
  • A population is in Hardy-Weinberg equilibrium at a locus with two alleles, A and a, each with a frequency of 0.5. A is completel
    5·1 answer
  • Lesions to the medial geniculate of the ___________ block conventional auditory fear conditioning.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!