2 years ago

Electrons can jump between energy levels but can never be found in what energy level

1 answer:

6 0

Answer:

Electrons can jump from energy level to energy level (for example energy level 1 to 2) but they can NEVER be found in between energy levels.

You might be interested in

What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

2 years ago

Una sola dosis de etanol, C2 H5 OH, eleva el nivel intracelular de iones calcio. Los iones Ca2+ liberados por el etanol 0,10 M m

11Alexandr11 [23.1K]

Answer:

No se bro cual se la respuesta .......

Explanation:

lo siento(

4 0

3 years ago

Enter your answer in the provided box.

nexus9112 [7]

Answer:

V₂ = 50.93 L

Explanation:

Initial volume, $V_1=43.1\ L$

Initial temperature, $T_1=24^{\circ} C=24+273=297\ K$

Final temperature, $T_2=78^{\circ} C=78+273=351\ K$

We need to find the final volume of the gas. The relation between the volume and the temperature is given by :

$\dfrac{V_1}{T_1}=\dfrac{V_2}{T_2}\\\\V_2=\dfrac{V_1T_2}{T_1}\\\\V_2=\dfrac{43.1\times 351}{297}\\\\V_2=50.93\ L$

So, the final volume of the gas is 50.93 L.

4 0

3 years ago

which one of the following groups are decomposers a. algae b. protist c. fungi d. green plants e. photosynthetic bacteria

alukav5142 [94]

Answer:c

Explanation:

7 0

2 years ago

A 225-g sample of aluminum was heated to 125.5 oc, then placed into 500.0 g water at 22.5 oc. (the specific heat of aluminum is

Sidana [21]

when heat gained = heat lost

when AL is lost heat and water gain heat

∴ (M*C*ΔT)AL = (M*C*ΔT) water

when M(Al) is the mass of Al= 225g

C(Al) is the specific heat of Al = 0.9

ΔT(Al) = (125.5 - Tf)

and Mw is mass of water = 500g

Cw is the specific heat of water = 4.81

ΔT = (Tf - 22.5)

so by substitution:

∴225* 0.9 * ( 125.5 - Tf) = 500 * 4.81 * (Tf-22.5)

∴Tf = 30.5 °C

7 0

3 years ago

Read 2 more answers