Answer:To find the volume of a rectangular prism, multiply its 3 dimensions: length x width x height. The volume is expressed in cubic units.
Explanation:To find the volume of a rectangular prism, multiply its 3 dimensions: length x width x height. The volume is expressed in cubic units.
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
The human protein coded by the human gene
Answer:
- i ngfgjmmhhjnbgtddfgnkiijhgggh
- hhjugfvbjuj
- creamy cheese
- tomorrow
- for the picnic
- and
- I
- play
- with
- the
- Afrikaans
- deadlyforce
- and
- you
- so much
- vedios
- there
- for
- Christmas
- nicky
- minaj
Explanation:
me like youwant it. no poploney
Answer:
A
Explanation:
Bacteria use binary fission but viruses don't
