1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
2 years ago
13

*multiple choice*

Chemistry
1 answer:
galben [10]2 years ago
7 0

1.95  or 2  is the molarity of a 45.3g sample of KNO3 (101g) dissolved in enough water to make a 0.225L solution.

The correct answer is option b

Explanation:

Data given:

mass of KNO_{3} = 45.3 grams

volume = 0.225 litre

molarity =?

atomic mass of KNO3 = 101 grams/mole

molarity is calculated by using the formula:

molarity = \frac{number of moles}{volume of the solution}

first the number of moles present in the given mass is calculated as:

number of moles = \frac{mass}{atomic mass of 1 mole}

number of moles = \frac{45.3}{101}

0.44 moles of KNO3

Putting the values in the equation of molarity:

molarity = \frac{0.44}{0.225}

molarity = 1.95

It can be taken as 2.

The molarity of the potassium nitrate solution is 2.

You might be interested in
The BEST example of diffraction is the image of
Rashid [163]
Please help me! i only need one more to be the best score

6 0
3 years ago
Read 2 more answers
What happens when sugar is heated? Give a balanced equation
mario62 [17]

Answer:

when the sugar is heated it turn out in caramelize

8 0
2 years ago
Which of the following statements is true about what happens during a chemical reaction?
tiny-mole [99]

Answer: The correct option is A.

Explanation: In a chemical reaction, reactants react to form a number of products.

For the formation of products, the bonds of the individual reactants must be broken and the bonds of the products must be formed.

For example: Formation of water from hydrogen gas and oxygen gas. Reaction follows:

2H_2(g)+O_2(g)\rightarrow 2H_2O(l)

The Bonds of hydrogen and oxygen molecule are broken and new bonds between hydrogen and oxygen atoms are formed to give water molecule.

5 0
2 years ago
Read 2 more answers
6.9 moles of oxygen gas in a fixed volume of 1.33 liters. One of the valves opened and there remains only 1.24 moles oxygen gas.
Romashka [77]

Answer:

The new volume of the gas remains the same. That is new volume of gas is 1.33 litres

Explanation:

This is because gases do not have a definite shape. They therefore take the shape of their containing vessels and hence their volumes are determined by the volume of the container.

For the question above even if some of the gas escapes, as long as there is gas present in the container, its volume remains the same, that is occupies the same space in the container

7 0
2 years ago
Which type of carbon fixation stores carbon dioxide in acid form? a. c3 b. c4 c. cam d. all of the above
Luba_88 [7]

The type of carbon fixation stores carbon dioxide in acid form is CAM i.e. crassulacean acid metabolism.

<h3>What are CAM?</h3>

CAM stands for crassulacean acid metabolism in this process photosynsthesis is occured at day time but the exchange of gases takes place at night itself only.

In this carbon fixation process, carbon dioxide is stored in the form of organic acid malic acid and losses carbon dioxide at the night time and by doing this it helps in the storage of water.

Hence option (C) is correct.

To know more about CAM, visit the below link:

brainly.com/question/4170802

8 0
2 years ago
Read 2 more answers
Other questions:
  • Question 19 Unsaved
    10·2 answers
  • What does the acronym VSEPR represent?
    11·2 answers
  • Which element in group 16 is most likely to gain an electron?
    11·1 answer
  • 11.39g PbCl2(s) 200.0 ML<br> Solve for m
    7·1 answer
  • Which halogen is the most easily oxidized?
    15·1 answer
  • A camper burned a piece of paper to start a campfire. is burning paper a physical or chemical change? why? 
    5·1 answer
  • What is the potential energy of the ball as it is half way through the fall, 20 meters high?
    13·1 answer
  • write down the name and molecular formula of the compound which gives hydrogen ion and chloride ion in the solution state. ​
    13·1 answer
  • Please help!!!!
    15·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!