The correct answer is "reefs".
Shallow-marine environments are considered to be an area among the shore and deeper water, along with a reef wall or a shelf break. This surroundings is characterized by means of oceanic, geological and organic conditions, as described underneath.
I believe the biosphere is fragile, because over time all of the pollution us humans have made; If its from air pulloution, acid rain or even water pollution. the toxic acids over time have made the biosphere and the ozon layer weaker and more thin. which causes the biosphere to become weaker.
It's important so that they know exactly where the disease started. Knowing who patient zero is helps them to identify who that person interacted with. From there, they can determine where the disease spread to. This will aid them in stopping the disease before it spreads any further.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
