1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
3 years ago
5

In which of the following does matter change into a new substance?

Chemistry
2 answers:
Kaylis [27]3 years ago
8 0
The answer would be a.chemical change
cestrela7 [59]3 years ago
4 0

Answer:

Chemical change

Explanation:

Matter changes into a new substance by changing into a chemical change. In a chemical change, the substance cannot be changed back to its previous state and a new substance is formed.

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Identify reagents necessary to convert cyclohexane into 1,3-cylohexadiene: notice that the starting material has no leaving grou
Vinvika [58]
<span>1,3-cylohexadiene i synthesized starting from cyclohexane in following 4 steps.

1) Free Radical Substitution Rxn:
 Halogenation of cyclohexane in the presence of UV yield chlorocyclohexane.

2) Elimination Rxn: Dehydrohalogenation of chlorocyclohexane yields cyclohexene.

3) Halogenation of Cyclohexene (Electrophillic Addition Rxn) gives 1,2-dihalocyclohexane.

4) Elemination Rxn: When dibromocyclohexane is treated with KOH and heated it gives 1,3-cyclohexadiene as shown below,</span>

4 0
3 years ago
Charlie is doing a scientific investigation about the properties of light energy. For his experiment, he points a flashlight at
matrenka [14]

Answer:

it would be A.

Explanation:

7 0
3 years ago
Read 2 more answers
Here is a list of ingredients for a simple cake:
cupoosta [38]
So really you only need to answer the first one because you have more than enough og everything. 2×(what)=14 then that will be your answer
3 0
4 years ago
Determine the empirical formula of the compound formed when 1.2g of magnesium reacts with 3.55g of chlorine.Take the molar mass
masha68 [24]

Explanation:

For Mg, (1.2 g Mg/24 g Mg) = 0.05 mol Mg.

For Cl, (3.55 g Cl/35.5 g Cl) = 0.1 mol Cl

So the ratio now is

Mg:Cl = 0.05 : 0.1 = 1:2

I got the 1:2 ratio by dividing both by the smallest number, which is 0.05 mol. Therefore, the empirical for formula of the substance is MgCl_2

5 0
3 years ago
Other questions:
  • What is the result of multiplying 2.5 times 10 to the power 10 by 3.5×10 to the power of -7
    15·1 answer
  • Given the ionic formula below, what is the charge on ion X? Be sure to
    14·1 answer
  • What are 2 things that a ROOT does for plants?
    10·2 answers
  • Answer of all please
    6·1 answer
  • 4. How many moles of oxygen gas are needed to react completely with<br> 3.0 moles of C2,H6.?
    8·1 answer
  • I WILL GIVE 50 POINTS AND BRAINLIEST TO WHO EVER ANSWERS THIS RIGHT AND FAST!!! PLS!!!!
    9·2 answers
  • What is the mass of 4.5 moles of Cu(NO3)2?
    7·1 answer
  • A 25.0 mL sample of HCI reacted with 20.0 mL of 2.00 M NaOH. What is the molarity of the HCI?
    15·1 answer
  • You are given 2 samples of different elements. One is a perfect cube and the other is an
    11·1 answer
  • What current (in a) is required to plate out 2. 96 g of nickel from a solution of ni2 in 27. 12 minutes?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!