1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
3 years ago
11

A shark eats a penguin that has recently been feeding on some krill. The penguin has 100 joules worth of energy, but the shark u

ltimately gains only about 10 joules. Where does the rest of the energy go? It is destroyed and cannot be recovered. It was used by the penguin as it tried to get away from the shark. It is used for cell functions or transformed to heat energy. It reverts back to the krill that the penguin ate.
Biology
2 answers:
aalyn [17]3 years ago
8 0

Answer:

Option C, It is used for cell functions or transformed to heat energy

Explanation:

In an ecosystem, the energy obtained by an organism I by consuming any other organism II is just the 10% of the total energy contained with in organism II. 90% of the energy of the organism is used by the organism itself to carry out various cellular metabolic processed and to provide energy for all other physical processed with in the body. Therefore, when a shark eats a penguin, it only gets 10 joules of energy (which is equal to 10% of total energy contained within the penguin)

Hence, option C is the correct answer.

AlladinOne [14]3 years ago
6 0
It is used for cell functions or transformed to heat energy
You might be interested in
1. What is the importance of scope and delimitation in a scientific research?
Deffense [45]
Answer the one i just posted
8 0
3 years ago
Which enzyme probably came from the bacterial living in the alkaline hot spring?
9966 [12]

Answer: water

Explanation:

6 0
3 years ago
Which two elements make up water?
umka21 [38]

Answer:

H = Hydrogen

O = Oxygen

Explanation:

5 0
3 years ago
Read 2 more answers
Examples of monosaccharides disaccharides and polysaccharides.
RUDIKE [14]

Answer:

Glucose, galactose, and fructose are common monosaccharides, whereas common disaccharides include lactose, maltose, and sucrose. Starch and glycogen, examples of polysaccharides, are the storage forms of glucose in plants and animals, respectively. The long polysaccharide chains may be branched or unbranched.

Explanation:

3 0
3 years ago
1 Which observation could lead to the conclusion
OlgaM077 [116]

Answer: 4

Explanation:

It is composed of a cell, but does not have

tissues.

5 0
3 years ago
Read 2 more answers
Other questions:
  • You are doing a mark-recapture experiment to determine the population size of the MendAliens living on an island in my back yard
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • 5 point
    15·2 answers
  • Gene genealogies can vary for different loci. What does this imply for species trees? Group of answer choices
    9·1 answer
  • Good mental health is the ability to __________.A.express feelings appropriatelyB.allow daily situations to cause excessive anxi
    5·2 answers
  • This type of injury could cause a lose of
    10·1 answer
  • A woman exerts 100n of force to lift a laundry basket weighing 75 n show work
    9·1 answer
  • In a separate maddyase experiment using (Et)-10nM, the reaction velocity is measured as 3uMS. What is the substrate concentratio
    5·1 answer
  • Which are functions of the digestive system?
    7·1 answer
  • between Mary’s and Amy’s organisms, which one would likely share a stronger evolutionary lineage with your organism? Explain you
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!