1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
12

3 The volume of a gas is 50.0 mL at 20.0 K. What will be the new

Chemistry
1 answer:
Damm [24]3 years ago
7 0

Answer:

C. 4.00 K

Explanation:

We can solve this using Charles's Law of the ideal gas. The law describes that when the pressure is constant, the volume will be directly proportional to the temperature. Note that the temperature here should only use the Kelvin unit. Before compressed, the volume of the gas is 50ml(V1) and the temperature is 20K (T1). After compressed the volume becomes 10ml(V2). The calculation will be:

V1 / T1= V2 / T2

50ml / 20K = 10ml / T2

T2= 10ml/ 50ml * 20K

T2= 4K

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
Match each part of the electrochemical cell with its function.
umka21 [38]

Hi!


The correct options would be:

1. Cathode - <em>reduction</em>

The cathode is the negatively charged electrode, and so has an excess of electrons. Cations (positively charged ions) are attracted to the cathode, and gain electrons to acquire a neutral charge. The process in which a gain of electron occurs is called reduction.


2. Anode - <em>oxidation</em>

The opposite occurs at the anode which is positively charged and attracts negatively charged ions, anions. These anions lose their electrons at the anode to acquire a neutral charge, and the process involving loss of electrons is known as oxidation.


3. Salt Bridge - <em>ion transport </em>

Salt bridge is a physical connection between the the anodic and cathodic half cells in an electrochemical cell and is a pathway that facilitates the flow of ions back and forth these half cells. Salt bridge is involved in maintaining a neutral condition in the electrochemical cells, and its absence would result in the accumulation of positive charge in the anodic cell, and negative charge in the cathodic cell.


4. Wire - <em>electron transport </em>

Wires have a universal role of being a pathway for the transport of electrons in circuit. This role is also the same in the wires involved in an electrochemical cells where they are used to transport electrons from the anodic half cell, and this electron transport results in the generation of electricity in the internal circuit of the electrochemical cell.


Hope this helps!

4 0
3 years ago
The activity of tocopherols is destroyed by
NikAS [45]
<span>A. Commercial cooking
</span>
3 0
2 years ago
Your dad is working on creating a brick border for the lake in your backyard each brick has a mass of 100 g and a volume of 20 c
wel

Answer:

5000kg/m³

Explanation:

density=mass/volume

d=m/v

d=100/20

=5g/cm³

g/cm³*1000=kg/m³

5g/m³*1000=5000kg/m³

4 0
2 years ago
Read 2 more answers
There are three sets of sketches below, showing the same pure molecular compound (hydrogen chloride, molecular formula ) at thre
RideAnS [48]

Answer:

The correct answer is - option C.

Explanation:

Given: the melting point of HCl is

-114.8 °C, which suggests that below this temperature HCl will be solid.

and, since the boiling point of HCl is - 85.1 °C. It is also suggested that above this temperature HCl will be gas, Therefore.

Solid -114.8  - Ordered arrangement

Liquid -85.1c  - Less orderly arranged

Gaseous - Least orderly arranged

Thus, at —90 °C, HCl will be present 'in the liquid state,  At — 1 °C, HCl will be present in the gaseous state and at -129 °C, HCl will be present in the solid-state. So, the molecules will be organized in a more orderly manner .

Thus, the correct answer is - option C

8 0
3 years ago
Other questions:
  • A solution of benzene in methanol has a transmittance of 28% in a 1.00 cm cell at a wavelength of 254 nm. only the benzene absor
    14·1 answer
  • Why Sncl2 is solid but SnCl4 is liquid at room temperature
    15·1 answer
  • An ion with 5 protons, 6 neutrons, and a charge of 3 has an atomic number of
    11·1 answer
  • Throughput is a term that refers to the amount of ?
    8·1 answer
  • 4.5 moles of sodium chloride NaCl is dissolved to make 0.15 liters of<br>solution.
    15·1 answer
  • An electrical company charges 15 p per unit of energy (kWh).
    14·1 answer
  • Which of the following changes on different celestial objects due to the force of gravity?
    10·1 answer
  • Which of the following is a definition for an interstitial alloy?
    5·1 answer
  • Nitrogen gas can be prepared by passing gaseous ammonia over solid copper (II) oxide at high temperatures. If 18.1 g of Nh3 is r
    11·1 answer
  • HELPPPPPPPPPPPP
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!