Answer:
Explanation:
Ok so it will be the first one but it migt be the second on for the simple fact that they both use CO2 and O2
I might be wrong because i am working on that to in my Bio class
Answer:
B
Explanation:
Cooling reduces the excitement of the molecules of the DNA hence allowing the hydrogen bonds between the base pairs of the two strands to form hence the DNA is considered to anneal. Heating disrupts the hydrogen bonds and causes the two strands to dissociate.
A nuclear power plant will use nuclear energy to power the town. While nuclear energy is perhaps one of the most effective ways to provide power, a nuclear accident is very dangerous, and could destroy an environment and its organisms. There was a nuclear accident in Chernobyl, Ukraine, in the 1900s. people had to evacuate because of it.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: More than 99 percent of all organisms that have ever lived on Earth are extinct. As new species evolve to fit ever changing ecological niches, older species fade away. But the rate of extinction is far from constant. At least a handful of times in the last 500 million years, 75 to more than 90 percent of all species on Earth have disappeared in a geological blink of an eye in catastrophes we call mass extinctions.
Though mass extinctions are deadly events, they open up the planet for new forms of life to emerge. The most studied mass extinction, which marked the boundary between the Cretaceous and Paleogene periods about 66 million years ago, killed off the nonavian dinosaurs and made room for mammals and birds to rapidly diversify