1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
13

Como trabaja el corazón con los pulmones para circular?

Biology
1 answer:
Galina-37 [17]3 years ago
3 0

El oxígeno que inhala del aire pasa a través de los pulmones a la sangre a través de los muchos capilares en los pulmones. La sangre rica en oxígeno se mueve a través de sus venas pulmonares hacia el lado izquierdo de su corazón y de la aorta hacia el resto de su cuerpo.

You might be interested in
What environmental factors had an impact on the coyote population?
mezya [45]

Answer:

More bunny's means more food for Coyotes

More food mean more coyotes in one area

4 0
3 years ago
Which of the following depicts a molecule of DNA?
allochka39001 [22]
The answer for this question would be B
7 0
3 years ago
Read 2 more answers
Which environmental changes occur faster?
Flura [38]
Im pretty certain it is volcanic eruption 
3 0
3 years ago
What is meant by evolution through natural selection
VikaD [51]
Hello!

Natural selection is the way that animals evolve. 

The theory of natural selection is that the animals that do not have a specific trait to survive in their environment will die. The animals that do have the trait will survive. The animals that survive will then pass the trait down to their offspring, who will also likely survive because they have the trait. This is how species evolve and continue to survive in their environment. 

The species evolve because only the fittest survive (this is known as "survival of the fittest"). The animals that do not have the needed traits will die and they cannot have offspring. 

I hope this helps answer your question! Have a great day!
4 0
3 years ago
During Fight or Flight response does the perception of light increase or decrease?
cestrela7 [59]

Answer:

Increase

Explanation:

It helps you to se better.

8 0
3 years ago
Other questions:
  • Which of the following is generally true of an X-linked recessive pedigree?
    9·1 answer
  • As water enters this plant cell structure, the cell becomes more turgid. This plant cell structure is the A) vacuole. B) cytopla
    6·2 answers
  • Name the three types of blood cells?
    5·2 answers
  • Select all that apply.
    9·1 answer
  • What is a cell membrane composed of?
    12·2 answers
  • What is the role of the water test tube in each phase
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • **10 POINTS**
    12·2 answers
  • Nuclear energy is a non-renewable energy source.<br> True<br> False
    11·2 answers
  • Explain how african feminism can help you to implement equal opportunities for male and female teachers at your school.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!