1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maksim [4K]
3 years ago
8

Which of the following is a characteristic property of noble gases? A. They only react with each other B. They do not react chem

ically C. They react violently in water D. They react violently in air.
Chemistry
1 answer:
tresset_1 [31]3 years ago
8 0

Answer:

B.They do not react chemically

Explanation:

This is because all noble gases haves full outer shell therefore they don’t participate in bonding.They are referred to as inert which means unreactive.

You might be interested in
What is the correct name for this formula: AI2O3?
agasfer [191]

Answer- A

Explanation- Because you have to look at the symbols and remember which symbol goes with each chemical, if you don't then you could get confused.

5 0
3 years ago
Determine the number of atoms that are in 1.15 mol of Cl 2.
Brums [2.3K]

Answer:

Explanation: I think its 4.91 x 10^25. Im not very sure, i just multipled 1.15 mol by the molar mass of Cl 2, which was 70.9 g. Then I multiplied that by avogadro's number. sorry if im wrong

4 0
3 years ago
What thype of bond requires the give and take of electrons ?
DedPeter [7]
Ionic bond involves electrostatic attraction between oppositely charged ions.
The ions are atoms that have gained 1 or more electrons and atoms that have lost 1 or more electrons.
<span>Answer: The type of bond that requires the give and take of electrons is Ionic bond</span>
6 0
4 years ago
Read 2 more answers
Determine the mole ratio between oxygen and water for the following equation:
vodka [1.7K]

Answer:2.2

Explanation:

5 0
3 years ago
What are natural resources
Angelina_Jolie [31]
Resources that come from nature, some examples include: Water, Gold, Oil, Coal, Apples, Oranges, etc. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • If a copper acetate hydrate, Cux(C2H3O2)y zH2O compound is found to contain 31.82% Copper, 59.14% acetate, and the remainder is
    11·1 answer
  • Cobalt-60 and iodine-131 are radioactive isotopes that are used in
    8·1 answer
  • What is the resistance of a fluid on an object?
    6·1 answer
  • A researcher is using a small molecule as an inhibitor to manipulate a signaling pathway. This inhibitor prevents phosphorylatio
    9·1 answer
  • Colton has an ice cube that has a mass of 4 grams. He places it in a sealed container and then puts it in the microwave on high.
    11·1 answer
  • Is Boiling water a chemical or physical change?
    13·1 answer
  • How to covert ethanol into 2-butanol.(show reaction)​
    10·1 answer
  • Can someone do this for me i wasent there when we learned it
    9·1 answer
  • What branch of science studies The Periodic Table? 
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!