Answer:
skin cells and muscles divide
Explanation: common sense cse we grow
Answer:
E. two of the above are correct
Explanation:
Fermentation reactions are processes that occur without the presence of oxygen and promote the release of energy (ATP) anaerobically. For these reactions to occur, glycolysis and reduction of pyruvate must occur.
These reactions allow the regeneration of NAD + that is necessary for the breakdown of glucose during the process called glycolysis, which is primarily responsible for the production of ATP. NAD + is regenerated from NADH.
With that, we can conclude that the correct options are:
B. often require the reactions of glycolysis to provide energy as ATP
C. supply NAD for the oxidation of glucose
NREM 3
The correct answer is: Stage 3
I hope that helped! c:
Answer:
The science experiment is designed to disprove or support the initial hypothesis. When the findings do not align with the hypothesis, the experiment is not a failure. When the results do not agree with the hypothesis, record the information just as if it did support the original hypothesis.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
