1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
6

According to the Acceptable Macronutrient Distribution Ranges for protein, an individual should consume between ______ and _____

_ grams of protein based on a 2,000 kilocalories diet.
Biology
1 answer:
snow_lady [41]3 years ago
8 0

Answer:

50 grams and 175 grams

Explanation

Acceptable macronutrient distribution range are predetermined ranges of intake of a specific macronutrient such as Proteins, carbohydrates and fats.

It was developed to promote healthy diet in the society.

According to the AMDR, the ranges of proteins should be 10-35 percent of the calories.

Therefore;

10/100×2000=200          

But 1g contains 4 kilocalories of protein so;

200kCal/4kcal=<u>50 grams</u>

<u>35/100×2000=700 kcal of protein so; </u>

<u>700kcal÷4kcal= 175 grams  </u>

You might be interested in
An individual's complete collection of genes is called his or her:
BabaBlast [244]

The right answer is genotype.

The genotype is the information carried by the genome of an organism, contained in each cell in the form of deoxyribonucleic acid DNA. Carried by the chromosomes, it is located inside the nucleus in eukaryotes and in cytoplasm in prokaryotes.

In humans, it is estimated that the number of genes is between 25,000 and 30,000.

7 0
3 years ago
Which shows the levels of organizational hierarchy listed from least complex to most complex?
TiliK225 [7]

Answer:

That would be organism, species, and then community.

Explanation:

3 0
3 years ago
The land management technique of _____ helps limit topsoil loss.
ValentinkaMS [17]

(strip cropping)   cultivation of crops in strips following the contours of the land to minimize erosion..... 

4 0
2 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The weight of an object is related to its
sattari [20]
Pull Of Gravity , that is why you have weight or else without gravitational pull you only have mass hence the equation w = mg
6 0
3 years ago
Other questions:
  • What type of tissue is found on the surface of the ovaries?
    10·1 answer
  • Why do you think most solid objects sink when put in liquids?
    7·1 answer
  • Which sentence uses the past form of the verb worry A. she worrying that the dress would not fit B.she worry that the dress will
    12·1 answer
  • What embryo-produced hormone maintains progesterone and estrogen secretion by the corpus luteum through the first trimester of p
    8·1 answer
  • 1. (1-4) What are the horizontal and vertical lines on a map called?
    14·1 answer
  • The molecule that brings amino acids to the ribosomes to be assembled into protiens is
    13·2 answers
  • PLS HELP DONT HAVE MUCH TIME
    11·1 answer
  • How do you write 2-3 paragraphs on evolutionary history/advances from the monerans to protists to fungi?
    8·1 answer
  • Which of the following demonstrates a predator/prey relationship?
    12·1 answer
  • Reason to be vegan:<br> plants dont feel pain <br> "thIs gUrl iS On c0ca1ne"
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!