1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
2 years ago
9

Which of these energy resources are renewable? Select all that apply.

Chemistry
2 answers:
cupoosta [38]2 years ago
7 0

Answers:

B. Wind

E. Tides

F. Geothermal energy

D. Forests

Explanation:

I took the test.

xz_007 [3.2K]2 years ago
4 0

The correct options are option B and D, that is, wind power and geothermal energy.  

The form of energy which is gathered from renewable resources is known as renewable energy. This form of energy gets restocked on a human timescale like wind, sunlight, tides, waves, rain, and geothermal heat.  

Renewable energy usually provides energy in four essential fields, that is, air and water heating/cooling, electricity generation, rural energy services, and transportation.  

You might be interested in
Which flower parts make up a pistil?
liberstina [14]

Answer:

B

Explanation

English - Hey, so I'm starting a little business. I'm going to be customizing shoes. If you want a pair of shoes please tell me. I will be putting another post with photos of shoes I've customized.

Spanish - Oye, estoy comenzando un pequeño negocio. Voy a personalizar zapatos. Si quieres un par de zapatos, dímelo. Estaré poniendo otra publicación con fotos de zapatos que he personalizado.

Insta account and website in progess

4 0
2 years ago
Matter is made up of heat energy and ___________energy?
ella [17]
You’re correct, matter is made up of heat energy and chemical energy

all matter contains heat because it is the result of the movement of atoms, molecules, or ions in solids, liquids, and gases.

all matter also contains chemical energy. chemical energy is stored in the bonds of chemical compounds so atoms and molecules are held together by chemical energy

hope this helps :)
3 0
2 years ago
If the rate law for a reaction A → P is rate = 3.37x10-3 M^-1 min-1 [A]^2 and the initial concentration of a is 0.122 M, calcula
DedPeter [7]

Rate = 3.37x10-3 M^-1 min-1 [A]^2 and the initial concentration of a is 0.122M.

A rate law indicates the rate of a chemical response depends on reactant concentration. For a response inclusive of the price regulation commonly has the form rate = ok[A]ⁿ, in which okay is a proportionality constant known as the fee regular and n is the order.

The charge of a chemical response is, perhaps, its maximum crucial asset because it dictates whether or not a reaction can arise all throughout an entire life. knowing the charge regulation, an expression concerning the price to the concentrations of reactants can assist a chemist to modify the response conditions to get an extra suitable rate.

half-life is the time taken for the radioactivity of a substance to fall to 1/2 its authentic cost whereas implies existence is the common life of all the nuclei of a particular risky atomic species.

Learn more about rate law here:-brainly.com/question/7694417

#SPJ4

3 0
2 years ago
Is hydrogen a neutral atom or ion
Sloan [31]

Answer:

Hydrogen is the smallest chemical element. It has one proton and one electron, making it neutral. However, the ions of hydrogen atom are charged species. Thus, the key difference between hydrogen atom and hydrogen ion is that the hydrogen atom is neutral whereas hydrogen ion carries a charge.

4 0
2 years ago
Read 2 more answers
A container with a fixed volume, filled with hydrogen gas at -104°C and 71.8 K PA is heated until the pressure reaches 225.9 K P
Daniel [21]

Answer:

The correct answer is 532 K

Explanation:

The Gay-Lussac law describes the behavior of a gas at constant volume, by changing the pressure or temperature. When is heated, the change in pressure of the gas is directly proportional to it absolute temperature (in Kelvin or K).

We have the following initial conditions:

P1= 71.8 kPa

T1= -104ºC +273 = 169 K

If the pressure increases until reaching 225.9 kPa (P2), we can calculate the final temperature of the gas (T2) by using the Gay-Lussac derived expression:

P1 x T2 = P2 x T1

⇒T2= (P2 x T1)/P1 = (225.9 kPa x 169 K)/71.8 kPa= 531.7 K ≅ 532 K

4 0
3 years ago
Other questions:
  • Write your question here (Keep it simple and clear to get the best answer)what are the different types of bleaching agent's
    10·1 answer
  • In a molecule of PCl3, 6 electrons will form
    9·1 answer
  • Choose the selection which correctly characterizes all three of the following substances in terms of whether they are polar or n
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • In which pair would both compounds have the same empirical formula? A. H2O and H2O2 B. BaSO4 and BaSO3 C. FeO and Fe2O3 D. C6H12
    8·1 answer
  • What are two ways in which mixtures differ from compounds??
    13·2 answers
  • (HELP I HAVE 10 MINS TO TURN IN) why is the nervous system in the human body a system?
    5·1 answer
  • What's the charge on Ni in the compound NiCi3? *
    12·1 answer
  • Which answer best describes what is happening in the following redox reaction?
    14·1 answer
  • Why is paper chromatography used for amino acids
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!