1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
10

Which stage of photosynthesis involves an electron transport chain? light dependent process light independent process calvin cyc

le krebs cycle?
Biology
1 answer:
Softa [21]3 years ago
8 0
Light-dependent process in a thylakoid membrane occurs in which electron transport takes place, for the production of energy. Solar energy is converted into chemical energy, for producing NADPH and ATP. They are then used for the synthesis of glucose, in a light-independent reaction.
You might be interested in
A couple in their mid-30s are at their primary care provider's office because they have been unable to conceive for 3 years. The
Lisa [10]

Answer:

TRUE

Explanation:

There are two types of infertility.

Primary infertility

Secondary infertility

In primary, couple have never conceived whereas secondary infertility refer to those couple who have been pregnant in the past at least once but now are unable to conceive

5 0
4 years ago
Imagine that a newly discovered, recessively inherited disease is expressed only in individuals with type O blood, although the
kirill [66]

Answer:

.

Explanation:

.

4 0
3 years ago
Which conclusion about the meaning of y is correct if the allele combination Yy is for yellow seed?
Ksju [112]
You have to do the cross-back before making any conclusions.
3 0
4 years ago
Read 2 more answers
More offspring are born in a population than can survive
Mila [183]

Answer:

Explanation:

Yes. Animals and humans have instincts. Every creature does. Most of the time offspring are born in populations that are thriving so their young and their genes can be passed on.

7 0
4 years ago
: Which of the following is not a sign of sepsis? Which of the following is not a sign of sepsis? increased white blood cell cou
natka813 [3]

Answer: The correct answer to the question is DILATED PUPILS.

DILATED PUPILS is not a sign of sepsis.

Explanation: Sepsis can be defined as the way our body system respond to infection or invasion of a foreign body into the body system.(usually bacterial infection)

When Sepsis becomes severe,it is injurious to organs of the body(affects their function in a negative way).

Sepsis occurs when the body's immune system tends to fight infection in the body by the release of certain chemicals(cytokines and prostaglandins),the body instead of reacting in a coordinated manner to these chemicals rather reacts out of proportion to these chemicals released to fight infection and this will lead damage to organs of the body system.

Sepsis is characterised by Fever(above 101°F (38.3°C) or below 96.8°F (36°C), increased in respiratory rate (more than 20 breaths per minute), Increased heart rate (more than 90 beats per minute),increased white blood cell count,low blood pressure and mental confusion.

Treatment of Sepsis includes the administration of antibiotics and intravenous fluid, administration of drugs to support blood pressure and administration of steroids.

5 0
4 years ago
Other questions:
  • What is the definition of multi-cellular?
    10·1 answer
  • Which drug can cause chemical burns? 1 Anthralin 2 Prednisone 3 Tazarotene 4 Calcipotriene
    10·1 answer
  • Choose the term that best matches the description given. Include the pathogen that causes AIDS
    7·1 answer
  • Why is the marine iguana endangered
    8·1 answer
  • What does the pulmonary artery do?
    13·2 answers
  • What is the name of the chemical the leech injects into the wound to keep the blood flowing so it can feed longer?
    15·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Which of the following are crucial to maintaining the balance of<br> the ecosystem?
    5·1 answer
  • A cell has a mutation that disrupts the insulin binding site of the insulin receptor. Based on the information in Figure 2, pred
    6·1 answer
  • Describing isotopes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!