1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nastasia [14]
4 years ago
8

Do you think a bar model would be a good model for converting miles to feet

Mathematics
2 answers:
borishaifa [10]4 years ago
5 0
Yes, in my opinion I think a bar model would be a good model for converting miles to feet. It is simple and easy to understand
AysviL [449]4 years ago
5 0
I think that a bar model would be a good model for converting miles to feet. In making a bar model, it would be easier to spot on the comparison of both equivalent values of miles and feet. But on the other hand, this also has limitations. This is only good for conversions with fixed, and whole numbers.
hope this helped

You might be interested in
The garden shown at right is divided into two section by a fence. If the quadrilateral section is a square, what is the square a
qaws [65]

The area of the triangle is 24 ft² while the area of the square is 64 ft²

<h3>What is an equation?</h3>

An equation is an expression that shows the relationship between two or more numbers and variables.

Area of triangle = (1/2) * base * height = 0.5 * 8 * 6 = 24 ft²

Area of square = 8 ft * 8 ft = 64 ft²

The area of the triangle is 24 ft² while the area of the square is 64 ft²

Find out more on equation at: brainly.com/question/2972832

#SPJ1

6 0
2 years ago
Pls help me with this! (Links=report)
xxMikexx [17]

Answer:

XZ=12 in

Step-by-step explanation:

area of a rhombus is A=pq/2

where p=WY=15.5 and A=93 and q=XZ

93=15.5(XZ)/2

93(2)=15.5(XZ)

186/15.5=XZ

XZ=12 in

7 0
4 years ago
I need help with 1 and 2 please :)
KIM [24]
The first one should be 7/26
4 0
3 years ago
If you have 9 bunches of flowers and there are 19 flowers in each bunch. How do you find the total amount?
ycow [4]
You would multiply 9 by 19. This is because there are 19 flowers in each bunch, and 9 bunches, that's 19, 9 times.
8 0
3 years ago
Read 2 more answers
In a lecture demonstration, an object is suspended from a spring scale which reads 8N when the object is in air. The object is t
katovenus [111]

Answer:

a) density of the object is 3995.01, b) the weight scale reads 22N c) the sum individually will be the same with when added together.

Step-by-step explanation:

The weight of the object in air is 8N,

and weight = Mass * acceleration due to gravity = m * 9.81

8/9.81 = 0.815,

upthrust( force acting on the body from the liquid impeding the immersion) on the body when fully submerged = weight in air - weight in water = 8N - 6N =2N

Upthrust = weight of water displaced = 2N = mass * acceleration

2/9.81 = 0.204kg

density of water(1000kg/m^3) = mass of water / volume of water

volume of water displaced = 0.204/1000 = 0.000204m^3 (204cm^3)

volume of water displaced = volume of the solid

density of solid = mass/ volume = 0.815/0.000204 = 3995.01kg/m^3

b) when fully submerge in water the the scale experience according to newton third law of motion ( equal and opposite reaction of forces) additional 2N push so that total weight with the fully submerge solid = 20N + upthrust = 20N + 2N =22N

c) the of two scale reading is before (8N + 20N = 28N) and after (6N + 22N = 28) since there is no loss of matter; the demonstration was in equilibrium.

6 0
4 years ago
Other questions:
  • Of the members of a student choir, 60% are boys. If there are 21 boys in the choir, how many members does the choir have in tota
    13·2 answers
  • he Hall family bought 9 bags of cookies. Each bag had 16 cookies. They have since eaten 25 of the cookies. How many cookies do t
    15·2 answers
  • Highest common factor of 92 and 42
    7·2 answers
  • The distance traveled, in miles, as a function of time, in hours, is defined by D(t). D(t) = Which times and distances are repre
    8·2 answers
  • Las Cruses, NM, is about 600 mi from Dallas, TX. One plane flies from Dallas to Las Cruses in 1 hr 12 min, and another plane wit
    9·1 answer
  • Can someone help with #3 and show your work !!
    10·2 answers
  • Please can someone help please
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please solve this equation and show work please tysm 3(g−7)=2(10+g)
    7·2 answers
  • The graph of a polynomial function of degree n meets the x-axis at most n times.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!