1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
2 years ago
14

Which statement best describes the limits of science?

Biology
2 answers:
liq [111]2 years ago
7 0

The correct answer is D. Science cannot answer philosophical answers.

Explanation:

Science refers to a system that aims at understanding natural phenomena by using knowledge based on observation, experimentation and other processes. Because of this, through science and the scientific method, it has been possible to get information about almost all aspects in the world and answer to all type of question including difficult or complex. However, because science relies on testing and observation questions related to aspects that cannot be observed, tested or that depend on the perception cannot be answered through science, this includes philosophical questions that deal with the sense of life and therefore cannot be answered through the scientific method as they are subjective. Thus, the statement that describes the limits of science is "science cannot answer philosophical answers".

pantera1 [17]2 years ago
3 0
I'll say C, Science cannot answer difficult question...let me know.
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
How do environmental conditions influence species survival?
velikii [3]

Answer: The threats of environmental changes to the fitness, survival and reproductive success of individuals, and ultimately to the survival of species and ecosystems come from many directions: habitat destruction, disruption of food chains, changes in disease and parasitic loads, increased pollution and direct and indirect

Explanation:

3 0
3 years ago
Genetic drift simulation:
Airida [17]
Unlike natural selection, genetic drift does not depend on an allele's beneficial or harmful effects. Instead, drift changes allele frequencies purely by chance, as random subsets of individuals (and the gametes of those individuals) are sampled to produce the next generation.
8 0
1 year ago
Juan received a class assignment to write about organisms that live in extreme environments. While doing research online, he fou
earnstyle [38]

Answer:

D. archea

Explanation:

8 0
1 year ago
How does a loess affect the environment around it?
WARRIOR [948]

Answer:

Because loess is deposited from the atmosphere it provides an important geologic archive of past atmospheric circulation that can be used to test atmospheric circulation models

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why is the sky blue? wrong answers only
    14·2 answers
  • Which is a consumer?<br> A. algae<br> B. human<br> C. cabbage<br> D. carnation
    5·2 answers
  • Unit test
    14·1 answer
  • Why do boreal forests have large reserves of organic carbon?
    8·1 answer
  • What happens when a part of the lymphatic system does not function?
    10·1 answer
  • Vitamins and minerals keep the blood healthy. Which part of the blood carries minerals, vitamins, and other nutrients to the bod
    5·1 answer
  • What composes the backbone, or side pieces, of the DNA molecule?
    14·1 answer
  • Can squirrels get cats pregnant?!?!?! please answer quickly :/
    6·2 answers
  • HIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
    10·2 answers
  • What effects does a high carbon level have on the deep ocean?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!