1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
3 years ago
14

Which statement best describes the limits of science?

Biology
2 answers:
liq [111]3 years ago
7 0

The correct answer is D. Science cannot answer philosophical answers.

Explanation:

Science refers to a system that aims at understanding natural phenomena by using knowledge based on observation, experimentation and other processes. Because of this, through science and the scientific method, it has been possible to get information about almost all aspects in the world and answer to all type of question including difficult or complex. However, because science relies on testing and observation questions related to aspects that cannot be observed, tested or that depend on the perception cannot be answered through science, this includes philosophical questions that deal with the sense of life and therefore cannot be answered through the scientific method as they are subjective. Thus, the statement that describes the limits of science is "science cannot answer philosophical answers".

pantera1 [17]3 years ago
3 0
I'll say C, Science cannot answer difficult question...let me know.
You might be interested in
Which compound is a metabolic intermediate of the light-independent reactions in photosynthesis?
Evgesh-ka [11]
Carbon dioxide is the compound in photosynthesis, I'm pretty sure
7 0
3 years ago
Read 2 more answers
Which group of organisms are examples of Molluscs?
ZanzabumX [31]

Answer:

Which group of organisms are examples of Molluscs?

Bivalves

Explanation:

5 0
4 years ago
f humans and chimpanzees only differ by 1.2% genetically, why are there such sizable differences phenotypically between the two
dsp73

Answer:

the differnt dna and rna strucures in the mammals cause differen tlooks they have also evolved from being in the wilf most of their lives

Explanation:

5 0
3 years ago
Look at the image. Recall the structures and parts of a flower. Use the drop-down menus to answer each question.
jek_recluse [69]

Answer:

The material covering the bee is called pollen, this material is produced from small spores that come from male trees and flowers.

Explanation:

3 0
4 years ago
Read 2 more answers
If a roller coaster train has a potential energy of 1,500 J and a kinetic energy of 500 J as it starts to travel downhill, its t
Gala2k [10]

Answer:

4kt

Explanation:

aint nobdy safe

7 0
4 years ago
Read 2 more answers
Other questions:
  • What allowed the sumerians to pursue activities other than finding food?
    6·1 answer
  • If dna directs the production of rna what does rna make
    15·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What were the two experiments that helped disprove spontaneous generation?
    8·1 answer
  • Which affect is one likely result of a forest fire
    9·2 answers
  • Elizabeth has always believed that people’s thoughts can help heal them. She wants to help people use positive thinking to posit
    10·1 answer
  • Is the circled karyotype a male or female?<br><br><br> female<br><br><br> male
    7·2 answers
  • The unusual amino acid selenocysteine is synthesized from ______ after it has been attached to certain tRNA molecules by the enz
    7·1 answer
  • HELP QUICK<br><br>What's a scientific law and what is it not?????​
    12·1 answer
  • Decide which of the following events in the history of DNA studies occurred first.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!