Answer:
3!!!
Explanation:
The segregation of homologous chromosomes
<span>It would die as harmful substances entered the cells.</span>
Answer:
Waxing crescent and first quarter
Explanation:
A waxing crescent moon is when the Moon looks like crescent and the crescent increases ("waxes") in size from one day to the next. This phase is usually only seen in the west. The first quarter moon (or a half moon) is when half of the lit portion of the Moon is visible after the waxing crescent phase.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.