1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
5

The first three items in the ingredients list on a bottle of orange juice are "sugar, citric acid, orange flavour." What does th

is mean? a. It states that sugar is the chief ingredient in the juice. b. It means that sugar and citric acid are beneficial for health. c. It explains the process of making orange juice. d. It states that no nutrients are present in the juice. e. It means that the orange juice does not contain water.
Biology
2 answers:
Elena-2011 [213]3 years ago
4 0

Answer: a) it states that sugar is the chief ingredient in the juice.

Explanation: In food labels, ingredients are listed in descending order, that ingredient present in high quantity is listed first and this ingredient is the main ingredient.

svetlana [45]3 years ago
3 0

Answer: Option A

It states that sugar is the chief ingredients.

Explanation:

Food labels on package of food shows different information about the ingredients used, the quantity and nutritional value.

In food label, ingredients are listed base on the most used, followed by the least used.

Sugar is listed first, it shows that it is used in greater amounts, followed by citric acid and orange flavour. Orange flavour is the least quantity used.

You might be interested in
Which is not an event of mitosis?
DanielleElmas [232]

Answer:

3!!!

Explanation:

The segregation of homologous chromosomes

5 0
2 years ago
What would happen to an organism if it's cell membranes became permeable to most substances
katrin [286]
<span>It would die as harmful substances entered the cells.</span>
8 0
3 years ago
Read 2 more answers
The face of the moon is only partially visible during which phase?
MariettaO [177]

Answer:

Waxing crescent and first quarter

Explanation:

A waxing crescent moon is when the Moon looks like crescent and the crescent increases ("waxes") in size from one day to the next. This phase is usually only seen in the west. The first quarter moon (or a half moon) is when half of the lit portion of the Moon is visible after the waxing crescent phase.

4 0
3 years ago
What location will enter darkness next as Earth's rotation continues ?​
Nataliya [291]

Answer:

well for me I think it's

Explanation:

the B

4 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • During DNA replication what would be complementary strand to the original DNA segment GCTAAT
    8·2 answers
  • A newly discovered unicellular organism isolated from acidic mine drainage is found to contain a cell wall, a plasma membrane, t
    13·1 answer
  • What are the characteristics of crustaceans,insects,and arachnids?
    13·1 answer
  • A scientist studies a species of duck. the male and female are about the same size. the females are brown, and the males are a b
    15·2 answers
  • The human appendix, a vestigial structure, is part of which structure.
    9·1 answer
  • All of the following techniques involve hybridization between single-stranded nucleic acid molecules except:
    14·1 answer
  • What’s the answer to this question?
    7·1 answer
  • Water located in wells underground is
    12·1 answer
  • En el texto la palabra "fotones" se podría reemplazar con A. "neutrones". B. "fonones". C. "ondas mecánicas". D. "cuantos de ene
    5·1 answer
  • I´ll give brainliest to the correct and most helpful answer!
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!