1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
5

List and describe at least three cellular features of bacteria that could be targeted to inhibit or kill a bacterial pathogen

Biology
1 answer:
lakkis [162]3 years ago
6 0
The bacterial cell membrane can be targeted for killing it. Inhibition of the synthesis of the components of cell wall will not allow the bacteria to grow.
The genetic material of the bacteria- DNA can be targeted. When DNA is cleaved, or damaged, then the bacteria will die.
The cellular components of the bacteria may be targeted. If a organelle, or a component is responsible for production or transport of proteins, and it is targeted by anti-bacterial compound, then protein synthesis machinery of bacteria will stop working, and it will not be able to perform a number of functions, and eventually die.
You might be interested in
Determine the genotypes of the parents if the father is blood type A, the mother is blood type B, the daughter is blood type O,
suter [353]

Answer: Mother is BO and the Father is AO

Explanation:

5 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which of these is a benefit of GMOs?
Eduardwww [97]

Answer:

c

Explanation:

all farmers are guaranteed a high percentage of strong healthy crops with GMO seeds.

6 0
3 years ago
Nora is driving on a snow-covered road, and her car begins to slide. The quick behavioral response and the increased heart rate
Elza [17]

Answer:

are most likely due to the fact that and are most likely due to the increased

6 0
3 years ago
Red blood cells are able to maintain homeostasis because they are bathed in blood, which is to the fluid in the cells themselves
Irina-Kira [14]

Answer:

this is not a question it is a statement

Explanation:

8 0
2 years ago
Other questions:
  • In humans, the placenta is essential to the embryo for
    13·1 answer
  • Compare and contrast pluripotent cells and totipotent cells
    9·1 answer
  • What feature would you expect to find in a population in which sexual selection depends on female choice?
    7·2 answers
  • Which best defines nitrogen fixation?
    7·2 answers
  • Question 7(Multiple Choice Worth 4 points)
    12·1 answer
  • Hueso más grande del esqueleto humano
    10·2 answers
  • Which most directly describes a benefit of using DNA technology in medicine?
    6·2 answers
  • What does the graph show the rate of temperature change over time?
    10·1 answer
  • The chytrid fungus, Batrachochytrium dendrobatidis, is a pathogenic fungus that has severely impacted frog populations around th
    10·1 answer
  • HURRY HELP ME WILL MARK BRAINLIEST
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!