<span>C2H5
First, you need to figure out the relative ratios of moles of carbon and hydrogen. You do this by first looking up the atomic weight of carbon, hydrogen, and oxygen. Then you use those atomic weights to calculate the molar masses of H2O and CO2.
Carbon = 12.0107
Hydrogen = 1.00794
Oxygen = 15.999
Molar mass of H2O = 2 * 1.00794 + 15.999 = 18.01488
Molar mass of CO2 = 12.0107 + 2 * 15.999 = 44.0087
Now using the calculated molar masses, determine how many moles of each product was generated. You do this by dividing the given mass by the molar mass.
moles H2O = 11.5 g / 18.01488 g/mole = 0.638361 moles
moles CO2 = 22.4 g / 44.0087 g/mole = 0.50899 moles
The number of moles of carbon is the same as the number of moles of CO2 since there's just 1 carbon atom per CO2 molecule.
Since there's 2 hydrogen atoms per molecule of H2O, you need to multiply the number of moles of H2O by 2 to get the number of moles of hydrogen.
moles C = 0.50899
moles H = 0.638361 * 2 = 1.276722
We can double check our math by multiplying the calculated number of moles of carbon and hydrogen by their respective atomic weights and see if we get the original mass of the hydrocarbon.
total mass = 0.50899 * 12.0107 + 1.276722 * 1.00794 = 7.400185
7.400185 is more than close enough to 7.40 given rounding errors, so the double check worked.
Now to find the empirical formula we need to find a ratio of small integers that comes close to the ratio of moles of carbon and hydrogen.
0.50899 / 1.276722 = 0.398669
0.398669 is extremely close to 4/10, so let's reduce that ratio by dividing both top and bottom by 2 giving 2/5.
Since the number of moles of carbon was on top, that ratio implies that the empirical formula for this unknown hydrocarbon is
C2H5</span>
Answer:
A hot spot is an area on Earth over a mantle plume or an area under the rocky outer layer of Earth, called the crust, where magma is hotter than surrounding magma. The magma plume causes melting and thinning of the rocky crust and widespread volcanic activity.
Hope this is what you mean be hot spot!
I hope this helps you!
Have a great day
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The element is Sodium with an atomic number of 11 and electrovalent bonding takes place when it comes near an atom having seven valence electrons.
<h3>What is Electrovalent bonding?</h3>
This is also referred to as ionic bonding and involves the transfer of atoms of an element to another.
In order for both of them to achieve a stable octet configuration, sodium donates one atom to the element seven valence electrons.
Read more about Electrovalent bonding here brainly.com/question/1979431
#SPJ1
The chemical reaction would be as follows:
<span>2Na + S → Na2S
We are given the amount of the reactants to be used in the reaction. We use these to calculate the amount of product. We do as follows:
45.3 g Na ( 1 mol / 22.99 g ) = 1.97 mol Na
105 g S ( 1 mol / 32.06 g ) = 3.28 mol S
The limiting reactant would be Na. We calculate as follows:
1.97 mol Na ( 1 mol Na2S / 2 mol Na ) (78.04 g / mol ) = 76.87 g Na2S produced</span>
