1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
14

According to the central dogma, what is the intermediate molecule involved in the flow of information in a cell that should go i

n the blank? dna → ________ → proteins
Biology
1 answer:
Tanya [424]3 years ago
6 0
The correct answer is RNA.  
<span>
The central dogma explains the flow of genetic information within a biological system. It is a simplified explanation for a gene expression. DNA is copied into mRNA during the process of transcription and the proteins are synthesized using the information in mRNA during the translation.</span>
You might be interested in
What do you think are the possible alleles for eye color in humans?
Sav [38]

Answer:

I'm not sure but i think its brown and blue

8 0
3 years ago
Why is nitrogen fixation such an important step in the nitrogen cycle?
Vikki [24]
The Answer to question number two is the sun
6 0
3 years ago
Read 2 more answers
During the G1 phase of interphase in mitosis, the cellular environment is evaluated to ensure conditions are appropriate to supp
andrew-mc [135]
It’s critical because it checks the cell for problems or mutations that could potentially harm it in later steps or make it like burst lol
3 0
3 years ago
Plant reproduction by tissue culture differs from reproduction by meristem culture because
Leviafan [203]

The answer is; B

Meristem cells are totipotent meaning they can differentiate to any type of plant cells. Therefore they can produce a variety of plant type depending on epigenetic. However, tissue culture is derived from already differentiated cells. Therefore these cells are already determined and can only produce cell type of that plant from which they were derived.    


4 0
3 years ago
Urgent please help!!!!!
antiseptic1488 [7]
I think the answer is most likely be J.

The first (F) one the population of the predator increases hugely while the population of the prey was neutral. And so both population didn’t seem to have any connection. Same goes for H. Graph G doesn’t make sense at all the population of the prey didn’t exist throughout the time in the graph but only exist in one single point of time and then just vanish again so that shouldn’t be the answer either.
In graph J, you can see the correlation between the two populations as the predator goes up and so does the prey.
You can search up on google predator-prey relationship graph to get better understanding.
6 0
3 years ago
Other questions:
  • Patrick and his partner Patricia recently had Lil Patty and Patricia is worried that the hospital made a mistake and mixed her b
    5·1 answer
  • A scientific model can be used to _______.
    8·2 answers
  • Using phase contrast microscopy on a wet mount of live cells, you observe motile bacilli moving rapidly and randomly through the
    13·1 answer
  • True or false? Many environmentalists believe that reducing human population growth could improve environmental issues.
    15·1 answer
  • A male cardinal’s red color is an example of a trait affected by natural selection. The females of the species choose mates base
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Motile sperm in fungi, plants, and animals depend upon ______ to drive the microtubule interaction in their flagella.
    15·2 answers
  • Explain the relationship between polypeptides and proteins .
    13·1 answer
  • Analyze the diagram below:
    12·1 answer
  • Make an argument for a "critical period" in language acquisition.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!