1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
4 years ago
11

Give two examples from the transformation of kinetic energy to potential one and vice versa

Biology
2 answers:
cupoosta [38]4 years ago
7 0

Answer:

throwing a ball, and going down a slide

Explanation:

Contact [7]4 years ago
7 0

Explanation:

potential- riding on roller skates, riding on a bike, walking, running

kinetic energy- flying airplane, car moving,yo yo in motion

You might be interested in
Which contains the least diversity of species?<br> a. order<br> b. phylum<br> c. family<br> d. class
Marysya12 [62]
The answer is C- Family.

8 0
3 years ago
5. Vascular plants have cells that carry water and other nutrients. One special type of
jolli1 [7]
Xylem carries water and dissolved nutrients
5 0
3 years ago
Chronic Wasting Disease is a fatal disease that affects deer, elk, and moose. To be safe, hunters should:
nikdorinn [45]

Hunters should never shoot, handle, or eat any animal that appears sick

6 0
4 years ago
Transcribe the strand of DNA CTA AGG TAG
alekssr [168]
CTA AGG TAG
GAT TCC ATC

In order to do this on your own all you need to do is reverse the letters A - T C - G
3 0
3 years ago
What are some examples of changes in traits that humans have influenced?
Varvara68 [4.7K]

https://www.pnas.org/content/98/10/5433 (this is where I got it from). Levels of soil nitrogen, phosphorus, calcium and pH, atmospheric CO2, herbivore, pathogen, and predator densities, disturbance regimes, and climate

6 0
3 years ago
Other questions:
  • A machine can never be 100% efficient because some work is always lost due to
    5·2 answers
  • People are biological creatures as well as rational human beings. In order to gain a complete understanding of any aspect of hum
    13·1 answer
  • What are the basic types of immune system cells? Select all that apply.
    12·1 answer
  • What's the name of biggest tries in the world?
    5·1 answer
  • Identify the structure shown below, describe it in detail. Make sure to include following points.
    7·1 answer
  • Please help!
    6·1 answer
  • What is the velocity of an object that moved from 0 meters to 14 meters in 2 seconds
    14·1 answer
  • Strains often occur as a result of lack of stretching before and after strenuous activity. Strains are an injury to a __________
    10·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • Argue why scientists should receive funding to record information about biodiversity
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!