Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
It would be 1,800 to 2,40p
Answer:
1. x chromosome
2.males
3.one X and one Y chromosome.
4. two X chromosomes
5. a very common trait in humans and frequently used to explain X-linked disorders.[8] Between seven and ten percent of men and 0.49% to 1% of women are affected. Its commonness may be explained by its relatively benign nature. It is also known as daltonism.
6.Females with one copy of the mutated gene are carriers. X-linked inheritance means that the gene causing the trait or the disorder is located on the X chromosome. Females have two X chromosomes while males have one X and one Y chromosome.
Explanation:
Hello. This question is incomplete. The full question is:
"Scientists are testing the effect of different scrubber technologies on the removal of pollutants from coal power plants. The scrubbers use a slurry of limestone and water. Which of the following best describes the impact of modifying the slurry by increasing the amount of limestone? The amount of sulfur dioxide released will decrease. A The amount of ground-level ozone released will decrease. B The amount of water released will increase. C The amount of carbon monoxide released will increase.
"
Answer:
The amount of sulfur dioxide released will decrease.
Explanation:
As you may already know, coal is a fossil fuel and burning it releases many toxic gases into the atmosphere, including sulfur dioxide.
A suspension of water and limestone, allows the calcium present in limestone to enter into reaction with sulfur dioxide, forming calcium sulfide and decreasing the emission of sulfur in the atmosphere.
The greater the amount of limestone in this suspension, the less sulfur dioxide will be released into the environment.
Answer: When the oxygen-rich blood gets to the cells, the cells receive the oxygen and release the carbon dioxide. The blood with less oxygen and a lot of carbon dioxide returns to the heart. Then the heart returns this blood to the lungs where carbon dioxide is released and oxygen is received.
Explanation:
