1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pychu [463]
3 years ago
7

Both aerobic and anaerobic respiration yield a net gain of ATP molecules to be used as energy for living things. The processes o

f _________ would yield the highest number of ATP.
Biology
2 answers:
ryzh [129]3 years ago
6 0

Answer: Oxidative Phosphorylation

Explanation:

Oxidative Phosphorylation in the eukaryotic mitochondrion is the best-understood example of this process

galben [10]3 years ago
4 0

Oxidative phosphorylation

You might be interested in
One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes
avanturin [10]

Answer:

It will enable gut enzymes to act on the bolus during digestion.

Explanation:

The acidic presence of HCl (hydrochloric acid) in the gastric juice serves as a stimulus for the intestinal wall to produce secretin.

This hormone will act on the pancreas by stimulating the production of pancreatic juice that will contain <u>enzymes</u> (trypsinogen, amylase, lipases) and <u>HCO3⁻</u> (bicarbonate) salts, which have base composition.

With this composition that will be sent to the duodenum, there will be neutralization of acidic solution coming from the stomach and pH leveling around 8.0 (slightly basic) which is great for the enzymes that work there.

5 0
2 years ago
The colonial protist, volvox, gives birth to daughter colonies directly from the mother colony. This type of reproduction ......
leva [86]

Answer: Asexual reproduction

Asexual reproduction is a mode of reproduction in which a single parent is involved to produce the offsprings. This occurs in simple organisms. This does not requires formation of gametes like sexual reproduction. The offsprings are identical to the parent organism. Here, mother colony of protists, volvox gives birth to daughter as only single parent is involved it is a asexual mode of reproduction.

3 0
3 years ago
Read 2 more answers
What do organisms from the ocean use the carbon dioxide for?
Yakvenalex [24]
To breathe, they use the <span>the carbon dioxide. Carbon dioxide is the main element which help the organisms to breathe.</span>
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Why are marshes more productive than bogs
ivolga24 [154]

The acidity of the soil-peat inhabits diversity of plant species compared to marshes.

An important distinction to bogs would be that marsh soils are more typically neutral in the pH scale, to slightly more basic.

Hope this helps! If it does, please go to my page and say thanks! Thankyou!

--Emilie Xx

8 0
3 years ago
Read 2 more answers
Other questions:
  • How do cells correct errors in DNA that would disrupt their function? Enzymes use the surrounding sections of the DNA to determi
    9·2 answers
  • Permatogonia in the seminiferous tubules are located ________. spermatogonia in the seminiferous tubules are located ________. c
    9·1 answer
  • What evidence suggests that the first tetrapods were amphibians?
    10·1 answer
  • The instructions for the genetic traits of an organism are directly determined by the
    9·2 answers
  • What is a spectogram?
    11·1 answer
  • What is the end result of natural selection?
    5·2 answers
  • What does this joke mean? ​
    12·2 answers
  • Please help!! i’ll mark brainliest
    5·1 answer
  • The diagram shows an experiment on the digestion of the protein in egg albumen by protease.
    5·1 answer
  • Sucrose (table sugar) is a disaccharide of glucose and fructose. Fructose (one of the products) is much sweeter than sucrose (th
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!