1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
12

Suggest how glucose got out of the model gut.​

Biology
1 answer:
Kitty [74]3 years ago
5 0
I need help with this one too.
You might be interested in
8-4 Discounting the Transverse Carrier Model. At one time, membrane biologists thought that transport proteins might act by bind
Natasha_Volkova [10]

Answer:

The two main reasons are nonpolar core of the bilayer and the active transport.

Explanation:

The membrane is structured to have two outer layers that are polar and an inner layer that is nonpolar.

If a membrane protein is exposed to the solvent, i<em>t will also have a polar side. It would be very difficult for the polar face of the membrane to move through the nonpolar core of the bilayer.</em> Therefore, this model is not feasible.

One major form of transport, active transport, moves solutes up the concentration gradient. <em>The binding of a solute and then release on another side of the membrane would only work for facilitated diffusion because it would cause a net movement of solutes down the concentration gradient.</em> It is unclear how energy could be expended to drive this process in the transverse carrier model.<em> Therefore, the transverse carrier model does not explain active transport.</em>

6 0
2 years ago
The arrow in a chemical equation means ________
allochka39001 [22]

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: It indicates the direction of the reaction

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

4 0
2 years ago
Of the following experimental results, which is the best evidence that photosynthesis is more efficient at certain wavelengths o
GarryVolchara [31]

Answer:

The correct answer will be option-C

Explanation:

The plant absorbs the sunlight to perform photosynthesis which helps produce the sugar molecule used by the plants.

The plants absorb maximum sunlight at two wavelengths that are red and blue wavelength by chlorophyll and other pigments. The efficiency of photosynthesis is also measured maximum at these two active wavelengths called action spectrum.

In the given question, since the efficiency of photosynthesis has been discussed which could be measured with the production of oxygen and consumption of carbon dioxide. The experiment performed by the Engelmann showed that aerobic bacteria got concentrated in the blue and red wavelengths as the output of the photosynthesis were observed maximum.

Thus, the selected option is the correct answer.

5 0
3 years ago
Summarize the four steps to natural selection
Anna11 [10]

Overproduction - An organism gives birth to too many children

Genetic Variation - The offspring each have genetic differences in appearance, behavior, etc

Struggle to Survive - Offspring must fight in order to gain essential resources (food, water, mates, etc)

Successful Reproduction - Organism produces offspring with beneficial adaptations that aid in survival

5 0
3 years ago
Oxygen released during potosythesis come from
natali 33 [55]

Answer:

plants

Explanation:

5 0
3 years ago
Other questions:
  • Which statement could be included in an accurate definition of biomes?
    15·1 answer
  • A ribosome builds a chain of amino acids in the proper sequence <br> a. True <br> b. False
    7·1 answer
  • Which statement describe the structure of each type of macromolecule
    8·1 answer
  • The maintenance of homeostasis a. involves using material culture to make living possible in certain settings. b. involves the s
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • In what stage of mitosis does the nuclear envelope disappear?
    6·1 answer
  • Why consumers would want GMO?
    15·1 answer
  • In pea plants the trait for tall height is dominant over the trait for dwarf height. Which letter should be used to represent th
    13·2 answers
  • How fast can you answer correct..? How fast can i give you brainliest. Explain Your answer:D/ HELP..............................
    15·2 answers
  • chloroplasts are proposed to have arisen after archaea cells engulfed , in endosymbiosis, allowing the engulfed cell to remain,
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!